Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGGACCCAATACTCGGAGACTGACTGTTAGCACATGGCTCCTTCGTCAGGGCCTCATTGACACCAGCCTGACGGCATCTGTGGCCAACTTACTGGCTATTGCAATCGAGAGGCACATTACGGTTTTCCGCATGCAGCTCCACACACGGATGAGCAACCGGCGGGTAGTGGTGGTCATTGTGGTCATCTGGACTATGGCCATCGTTATGGGTGCTATACCCAGTGTGGGCTGGAACTGTATCTGTGATATTGAAAATTGTTCCAACATGGCACCCCTCTACAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
human ... LPAR1(1902)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Songbai Lin et al.
The American journal of pathology, 188(2), 353-366 (2017-11-13)
Intestinal epithelial cells form a barrier that is critical in protecting the host from the hostile luminal environment. Previously, we showed that lysophosphatidic acid (LPA) receptor 1 regulates proliferation of intestinal epithelial cells, such that the absence of LPA1 mitigates
Hui Ying Li et al.
Kidney international, 91(6), 1362-1373 (2017-01-24)
Lysophosphatidic acid (LPA) is known to regulate various biological responses by binding to LPA receptors. The serum level of LPA is elevated in diabetes, but the involvement of LPA in the development of diabetes and its complications remains unknown. Therefore
Huai-Bin Hu et al.
Nature communications, 12(1), 662-662 (2021-01-30)
Dynamic assembly and disassembly of primary cilia controls embryonic development and tissue homeostasis. Dysregulation of ciliogenesis causes human developmental diseases termed ciliopathies. Cell-intrinsic regulatory mechanisms of cilia disassembly have been well-studied. The extracellular cues controlling cilia disassembly remain elusive, however.
Debashish Sahay et al.
Oncotarget, 6(24), 20604-20620 (2015-06-23)
Lysophosphatidic acid (LPA) is a bioactive lipid promoting cancer metastasis. LPA activates a series of six G protein-coupled receptors (LPA1-6). While blockage of LPA1in vivo inhibits breast carcinoma metastasis, down-stream genes mediating LPA-induced metastasis have not been yet identified. Herein
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service