Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGGCACTGAAGGACTACGCGCTAGAGAAGGAAAAGGTTAAGAAGTTCTTACAAGAGTTCTACCAGGATGATGAACTCGGGAAGAAGCAGTTCAAGTATGGGAACCAGTTGGTTCGGCTGGCTCATCGGGAACAGGTGGCTCTGTATGTGGACCTGGACGACGTAGCCGAGGATGACCCCGAGTTGGTGGACTCAATTTGTGAGAATGCCAGGCGCTACGCGAAGCTCTTTGCTGATGCCGTACAAGAGCTGCTGCCTCAGTACAAGGAGAGGGAAGTGGTAAATAAAGATGTCCTGGACGTTTACATTGAGCATCGGCTAATGATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MCM7(4176)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wenjie Li et al.
Molecular medicine reports, 14(6), 5334-5342 (2016-10-26)
Simvastatin (SIM), a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, has been reported to inhibit the activity of hepatitis B virus (HBV), however, the mechanism underlying its antiviral function remains unknown. Minichromosome maintenance (MCM) 7, a component of the MCM complex, has been reported to
E P Erkan et al.
Oncogene, 33(39), 4778-4785 (2013-10-30)
Minichromosome maintenance (MCM) proteins are key elements that function as a part of the pre-replication complex to initiate DNA replication in eukaryotes. Consistent with their roles in initiating DNA replication, overexpression of MCM family members has been observed in several
Kyle M Kovary et al.
Molecular systems biology, 14(5), e7997-e7997 (2018-05-16)
Due to noise in the synthesis and degradation of proteins, the concentrations of individual vertebrate signaling proteins were estimated to vary with a coefficient of variation (CV) of approximately 25% between cells. Such high variation is beneficial for population-level regulation
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU097271-50UG | 04061828353798 |
| EHU097271-20UG | 04061828588268 |