Skip to Content
Merck
CN

EHU095951

MISSION® esiRNA

targeting human PXN (1)

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human PXN (1)

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGACAACAGGCCCTGAGAAGCTAAGCGATTTGCCCTGTGGCATGGATGGTAGAGAGGGGAGCTGGCACTTGAACTCAGGTCTGGCTCGACCTCAGAATGAGTGATCTTGTGTCTCTGTGCCCCAGGACTGCATCCTCTCACCAATACTTCACCAGCCTAGGGATCTGTGCTCCCAAGAGCCTGTTGACATTGTAAACCTGAATCCAATCCATAAACCAAAAGCCCAGGCTTAGAATCACATTGTGGTGGAGCGGGTGTTTGGTGGAGTCCCTGATTCAAAATGTTTGACAAGGAAGCCTGACC

Ensembl | human accession no.

ENSG00000089159

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... PXN(5829), PXN(5829)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
JBS
QCS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tobias Pasqualon et al.
Oncotarget, 6(31), 31295-31312 (2015-09-18)
Syndecan-1 is a surface expressed heparan sulphate proteoglycan, which is upregulated by several tumor types and involved in tumor cell migration and metastasis. Syndecan-1 is shed from the cell surface and the remaining transmembrane fragment undergoes intramembrane proteolysis by γ-secretase.
Ludiane Gauthier et al.
Cancer research, 77(24), 7072-7082 (2017-10-13)
CD8
Wen-Chung Tsai et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 35(11), 2506-2512 (2017-02-25)
Platelet rich plasma (PRP) contains various cytokines and growth factors which may be beneficial to the healing process of injured muscle. The aim of this study was to investigate the effect and molecular mechanism of PRP on migration of skeletal
Panfeng Fu et al.
Pulmonary circulation, 5(4), 619-630 (2015-12-24)
Paxillin is a multifunctional and multidomain focal adhesion adaptor protein. It serves as an important scaffolding protein at focal adhesions by recruiting and binding to structural and signaling molecules. Paxillin tyrosine phosphorylation at Y31 and Y118 is important for paxillin
Yi-Ping Shih et al.
Cancer letters, 398, 46-51 (2017-04-15)
DLC1 is a RhoGAP-containing tumor suppressor that inhibits angiogenesis by repressing VEGF production in epithelial cells. Here we report the roles of DLC1 in endothelial cells. Silencing of DLC1 (siDLC1) enhances cell migration but reduces tube formation activities of human
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service