Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGACAACAGGCCCTGAGAAGCTAAGCGATTTGCCCTGTGGCATGGATGGTAGAGAGGGGAGCTGGCACTTGAACTCAGGTCTGGCTCGACCTCAGAATGAGTGATCTTGTGTCTCTGTGCCCCAGGACTGCATCCTCTCACCAATACTTCACCAGCCTAGGGATCTGTGCTCCCAAGAGCCTGTTGACATTGTAAACCTGAATCCAATCCATAAACCAAAAGCCCAGGCTTAGAATCACATTGTGGTGGAGCGGGTGTTTGGTGGAGTCCCTGATTCAAAATGTTTGACAAGGAAGCCTGACC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PXN(5829)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Panfeng Fu et al.
Pulmonary circulation, 5(4), 619-630 (2015-12-24)
Paxillin is a multifunctional and multidomain focal adhesion adaptor protein. It serves as an important scaffolding protein at focal adhesions by recruiting and binding to structural and signaling molecules. Paxillin tyrosine phosphorylation at Y31 and Y118 is important for paxillin
Wen-Chung Tsai et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 35(11), 2506-2512 (2017-02-25)
Platelet rich plasma (PRP) contains various cytokines and growth factors which may be beneficial to the healing process of injured muscle. The aim of this study was to investigate the effect and molecular mechanism of PRP on migration of skeletal
Tobias Pasqualon et al.
Oncotarget, 6(31), 31295-31312 (2015-09-18)
Syndecan-1 is a surface expressed heparan sulphate proteoglycan, which is upregulated by several tumor types and involved in tumor cell migration and metastasis. Syndecan-1 is shed from the cell surface and the remaining transmembrane fragment undergoes intramembrane proteolysis by γ-secretase.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU095951-20UG | 04061828599936 |
| EHU095951-50UG | 04061828365425 |