Skip to Content
Merck
CN

EHU095251

MISSION® esiRNA

targeting human MUC1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTTCAGGCCAGGATCTGTGGTGGTACAATTGACTCTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGGAGACACAGTTCAATCAGTATAAAACGGAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGTGAGTGATGTGCCATTTCCTTTCTCTGCCCAGTCTGGGGCTGGGGTGCCAGGCTGGGGCATCGCGCTGCTGGTGCTGGTCTGTGTTCTGGTTGCGCTGGCCATTGTCTATCTCATTGCCTTGGCTGTCTGTCAGTGCCGCCGAAAGAACTACGGGCAGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ping Li et al.
International journal of clinical and experimental pathology, 8(9), 10365-10374 (2015-12-01)
Muc-1 is a member of the carbohydrate-binding protein family that contributes to neoplastic transformation, tumor survival, angiogenesis, and metastasis. The aim of this study is to investigate the role of muc-1 in human oral squamous cell carcinoma progression. In this
Satomi Shiba et al.
The Journal of surgical research, 238, 79-89 (2019-02-15)
Mucin1 (MUC1), a member of the mucin family, is a glycoprotein which is often expressed in malignant cells. However, the expression and function of MUC1 in human duodenal adenocarcinoma (DAC) has not yet been characterized because of its low frequency.
Mei Guo et al.
International immunopharmacology, 88, 106850-106850 (2020-08-11)
Targeted clearance of colorectal cancer stem cells (CCSCs) has become a novel strategy for tumor immunotherapy. Molecule mucin1 (MUC1) is one of targetable cell surface antigens in CCSCs. However, the critical role of MUC1 in anti-tumor effects of CCSC vaccine
Ashujit Tagde et al.
Oncotarget, 8(41), 69237-69249 (2017-10-21)
The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM
Dina Stroopinsky et al.
Journal of cellular and molecular medicine (2018-05-16)
Acute myeloid leukaemia (AML) is an aggressive haematological malignancy with an unmet need for improved therapies. Responses to standard cytotoxic therapy in AML are often transient because of the emergence of chemotherapy-resistant disease. The MUC1-C oncoprotein governs critical pathways of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service