Skip to Content
Merck
CN

EHU093641

MISSION® esiRNA

targeting human TGFB1I1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Quality Level

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTAGATCGGTTGCTTCAGGAACTTAATGCCACTCAGTTCAACATCACAGATGAAATCATGTCTCAGTTCCCATCTAGCAAGGTGGCTTCAGGAGAGCAGAAGGAGGACCAGTCTGAAGATAAGAAAAGACCCAGCCTCCCTTCCAGCCCGTCTCCTGGCCTCCCAAAGGCTTCTGCCACCTCAGCCACTCTGGAGCTGGATAGACTGATGGCCTCACTCTCTGACTTCCGCGTTCAAAACCATCTTCCAGCCTCTGGGCCAACTCAGCCACCGGTGGTGAGCTCCACAAATGAGGGCTCCCCATCCCCACCAGAGCCGACTGGCAAGGGCAGCCTAGACACCATGCTGGGGCTGCTGCAGTCCGACCTCAGCCGCCGGGGTGTTCCCACCCAGGCCAAAGGCCTCTGTGGCTCCTGCAATAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TGFB1I1(7041)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

J Paul et al.
Mucosal immunology, 11(2), 427-436 (2017-06-15)
Intestinal fibrosis is a major complication in inflammatory bowel diseases, but the regulatory mechanism that inhibits fibrosis remains unclear. Here we demonstrate that Itch-/-myofibroblasts express increased amounts of profibrotic collagen type I and α-SMA in response to IL-17. Mechanistically, we
Razan Sheta et al.
Oncotarget, 8(47), 82506-82530 (2017-11-16)
The molecular basis of epithelial ovarian cancer (EOC) dissemination is still poorly understood. We have previously identified the hydrogen peroxide-inducible clone-5 (Hic-5) gene as hypomethylated in high-grade (HG) serous EOC tumors, compared to normal ovarian tissues. Hic-5 is a focal
Sonsoles Piera-Velazquez et al.
Rheumatology (Oxford, England), 59(10), 3092-3098 (2020-05-23)
SSc is a systemic fibrotic disease affecting skin, numerous internal organs and the microvasculature. The molecular pathogenesis of SSc tissue fibrosis has not been fully elucidated, although TGF-β1 plays a crucial role. The Hic-5 protein encoded by the TGF-β1-inducible HIC-5
Rishel B Vohnoutka et al.
Molecular biology of the cell, 30(25), 3037-3056 (2019-10-24)
Focal adhesion (FA)-stimulated reorganization of the F-actin cytoskeleton regulates cellular size, shape, and mechanical properties. However, FA cross-talk with the intermediate filament cytoskeleton is poorly understood. Genetic ablation of the FA-associated scaffold protein Hic-5 in mouse cancer-associated fibroblasts (CAFs) promoted

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service