Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EHU093481

Sigma-Aldrich

MISSION® esiRNA

targeting human CFLAR

Sign Into View Organizational & Contract Pricing
All Photos(1)
UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATGCTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTTCTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTACAGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAGACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATTGGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATGGGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAACTAAATCTGGTTGCCCCAGA

Ensembl | human accession no.

ENSG00000003402

NCBI accession no.

NM_003879

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CFLAR(8837) , CFLAR(8837)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

X Song et al.
Cell death & disease, 4, e577-e577 (2013-04-06)
Colorectal cancer is the third leading cause of cancer-related mortality in the world; the main cause of death of colorectal cancer is hepatic metastases, which can be treated with hyperthermia using isolated hepatic perfusion (IHP). In this study, we report
Yao Wang et al.
Frontiers in oncology, 9, 857-857 (2019-09-26)
Immune checkpoint blockade of programmed cell death protein 1 (PD-1) had an impressive long-lasting effect in a portion of advanced-stage melanoma patients, however, this therapy failed to induce responses in several patients; how to increase the objective response rate is
Tae-Eun Kim et al.
Oncotarget, 8(8), 13957-13970 (2017-01-14)
In this study, we examined the molecular mechanism underlying the resistance of cancer cells to R27T, a glycoengineered version of recombinant human interferon (IFN)-β1a, and sought to overcome R27T resistance through combination therapy. R27T has been shown to induce anti-proliferation
H H Cheung et al.
Cell death & disease, 2, e146-e146 (2011-04-15)
Smac mimetic compounds (SMCs) are experimental small molecules that induce tumour necrosis factor alpha (TNFα)-dependent cancer cell death by targeting the inhibitor of apoptosis proteins. However, many cancer cell lines are resistant to SMC-mediated apoptosis despite the presence of TNFα.
Therese Bredholt et al.
Molecular cancer, 8, 101-101 (2009-11-17)
An organic extract of the recreational herb khat (Catha edulis Forsk.) triggers cell death in various leukemia cell lines in vitro. The chemotherapeutics camptothecin, a plant alkaloid topoisomerase I inhibitor, was tested side-by-side with khat in a panel of acute
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service