Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGAAGATTGGCCTCTTTCCTTTCTCTAAGACAAACCTAAGTAAAAGCCTGAGCTTTGAGTCCTATGCTCAGCACACGGGAAGGAGATGTTAATAATTAAAATAAAGTTGATATCCTGTCTTTAGGGAGTTCCCTTGATCTCTTGAAAGAGACACAGCCCCATTTACATTATTTCGTGGATTTCACCAGCATAGTATAGTTTTTTTCTGTAAGTCCCTCATTCTTATGTAATAACAGGTGGAACTGAGGTTTGAAGAACCTCAGTGGCCCATCCTGATGACATTGGAGACTCAAAGAGACAAGAGAGAGTAGGGTTTAAAACCTGAGCTTTAAGACTCCCACTAGCTTCGTGTCCTTTGGCATGTTAACGTGCCTCAGTTTCCTCATCTGTATAATGGGGATATATGAAAGGCACCAGTCCTAAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FTO(79068)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
常规特殊物品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dong Xu et al.
Oncology reports, 38(4), 2285-2292 (2017-08-30)
Fat mass and obesity associated (FTO) is a protein-coding gene. FTO gene is an obesity related gene, also known as the obesity gene. It has been reported previously that FTO is associated with a variety of malignant cancers, such as
Ziqi Ye et al.
Oncology letters, 20(2), 1409-1417 (2020-07-30)
Liver cancer is the fourth leading cause of cancer-associated mortality worldwide. Statistics indicate that the incidence of liver cancer has been increasing and that its prognosis remains poor. Fat mass and obesity-associated protein (FTO) is a demethylase that is involved
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU092071-50UG | 04061828361779 |
| EHU092071-20UG | 04061831355871 |