Skip to Content
Merck
CN

EHU089751

MISSION® esiRNA

targeting human RUNX2

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTACCAGATGGGACTGTGGTTACTGTCATGGCGGGTAACGATGAAAATTATTCTGCTGAGCTCCGGAATGCCTCTGCTGTTATGAAAAACCAAGTAGCAAGGTTCAACGATCTGAGATTTGTGGGCCGGAGTGGACGAGGCAAGAGTTTCACCTTGACCATAACCGTCTTCACAAATCCTCCCCAAGTAGCTACCTATCACAGAGCAATTAAAGTTACAGTAGATGGACCTCGGGAACCCAGAAGGCACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCGCCTCAGTGATTTAGGGCGCATTCCTCATCCCAGTATGAGAGTAGGTGTCCCGCCTCAGAACCCACGGCCCTCCCTGAACTCTGCACCAAGTCCTTTTAATCCACAAGGACAGAGTCAGATTACAGACCCCAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mingkun Han et al.
OncoTargets and therapy, 11, 6305-6316 (2018-10-16)
It was previously reported that downregulation of miR-218 promoted thyroid cancer cell invasion, migration, and proliferation. However, the biological functions of miR-218 and its possible regulatory mechanisms in papillary thyroid cancer (PTC) cells are still elusive. The expression levels of
Chen-Ling Zhang et al.
Biochemical and biophysical research communications, 482(4), 1469-1476 (2016-12-15)
Deregulation of epigenetic modification by microRNAs (miRNAs) contributes to the development of estrogen deficiency, a hallmark of the multigenic endocrine disorder polycystic ovary syndrome (PCOS), but its etiology remains unclear. Previous study has pointed to a tight association between miR-320a
Rajnee Kanwal et al.
Cancer letters, 430, 25-33 (2018-05-19)
The role of CD133 (Prominin-1) as a cancer stem cell marker may be useful for therapeutic approaches and prognostication in prostate cancer patients. We investigated the stem-cell-related function and biological features of a subpopulation of CD133+ cells isolated from established primary
Uwe Raaz et al.
Circulation research, 117(6), 513-524 (2015-07-26)
Accelerated arterial stiffening is a major complication of diabetes mellitus with no specific therapy available to date. The present study investigates the role of the osteogenic transcription factor runt-related transcription factor 2 (Runx2) as a potential mediator and therapeutic target
Engin Kaptan et al.
Journal of cellular biochemistry, 118(11), 3911-3919 (2017-04-09)
Runx2 promotes metastatic ability of cancer cells by directly activating some of the mediators regarding malignancy. Galectin-3 (Gal-3) extensively expressed in normal and transformed cells and it is responsible for many cellular processes. In this study, we aimed to investigate

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service