Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EHU079451

Sigma-Aldrich

MISSION® esiRNA

targeting human GSK3B

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATCATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGTGAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATACAGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTGTATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGGGATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCG

Ensembl | human accession no.

ENSG00000082701

NCBI accession no.

NM_002093

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GSK3B(2932) , GSK3B(2932)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Baocheng Hu et al.
The Journal of biological chemistry, 292(8), 3531-3540 (2017-01-18)
miR-21, as an oncogene that overexpresses in most human tumors, is involved in radioresistance; however, the mechanism remains unclear. Here, we demonstrate that miR-21-mediated radioresistance occurs through promoting repair of DNA double strand breaks, which includes facilitating both non-homologous end-joining
Benjamin Stump et al.
PloS one, 14(4), e0213831-e0213831 (2019-04-10)
Lymphatic vessels play an important role in health and in disease. In this study, we evaluated the effects of GSK3-β inhibition on lung lymphatic endothelial cells in vitro. Pharmacological inhibition and silencing of GSK3-β resulted in increased lymphangiogenesis of lung
Linna Liu et al.
Oncology reports, 32(4), 1395-1400 (2014-08-12)
Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells.
Javier Duran et al.
PloS one, 11(12), e0168255-e0168255 (2016-12-16)
Testosterone induces cardiac hypertrophy through a mechanism that involves a concerted crosstalk between cytosolic and nuclear signaling pathways. Nuclear factor of activated T-cells (NFAT) is associated with the promotion of cardiac hypertrophy, glycogen synthase kinase-3β (GSK-3β) is considered to function
M S Rashid et al.
Scientific reports, 8(1), 14259-14259 (2018-09-27)
The mitotic checkpoint ensures proper chromosome segregation; defects in this checkpoint can lead to aneuploidy, a hallmark of cancer. The mitotic checkpoint blocks progression through mitosis as long as chromosomes remain unattached to spindle microtubules. Unattached kinetochores induce the formation
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service