Skip to Content
Merck
CN

EHU075631

MISSION® esiRNA

targeting human AL358113.1, TJP2

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTTGGGAGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAAGATGGCAACCTTCACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTGAGAACATGTCTTTAACGGATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACTACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCAACATCCCGTCATTAAATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAAACCGATCATTTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCTCAAGTGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCCAGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAGTTGTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Alexander X Cartagena-Rivera et al.
Nature communications, 8(1), 1030-1030 (2017-10-19)
Maintenance of epithelial tissue integrity requires coordination between cell-cell adherens junctions, tight junctions (TJ), and the perijunctional actomyosin cytoskeleton. Here we addressed the hypothesis that alterations in TJ structure and remodeling of the actomyosin cytoskeleton modify epithelial mechanics. Current methods
Arturo Raya-Sandino et al.
Biochimica et biophysica acta. Molecular cell research, 1864(10), 1714-1733 (2017-05-31)
Silencing Zonula occludens 2 (ZO-2), a tight junctions (TJ) scaffold protein, in epithelial cells (MDCK ZO-2 KD) triggers: 1) Decreased cell to substratum attachment, accompanied by reduced expression of claudin-7 and integrin β1, and increased vinculin recruitment to focal adhesions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service