Skip to Content
Merck
CN

EHU075421

MISSION® esiRNA

targeting human BCL6

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAGGCATTGGTGAAGACAAAATGGCCTCGCCGGCTGACAGCTGTATCCAGTTCACCCGCCATGCCAGTGATGTTCTTCTCAACCTTAATCGTCTCCGGAGTCGAGACATCTTGACTGATGTTGTCATTGTTGTGAGCCGTGAGCAGTTTAGAGCCCATAAAACGGTCCTCATGGCCTGCAGTGGCCTGTTCTATAGCATCTTTACAGACCAGTTGAAATGCAACCTTAGTGTGATCAATCTAGATCCTGAGATCAACCCTGAGGGATTCTGCATCCTCCTGGACTTCATGTACACATCTCGGCTCAATTTGCGGGAGGGCAACATCATGGCTGTGATGGCCACGGCTATGTACCTGCAGATGGAGCATGTTGTGGACACTTGCCGGAAGTTTATTAAGGCCAGTGAAGCAGAGATGGTTTCTGCCATCAAGCCTCCTCGTGAAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BCL6(604), BCL6(604)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Britta Jasmer et al.
Oncotarget, 8(65), 108643-108654 (2018-01-10)
The oncogene B-cell lymphoma 6 (BCL6) is associated with lymphomagenesis. Intriguingly, its expression is increased in preeclamptic placentas. Preeclampsia is one of the leading causes of maternal and perinatal mortality and morbidity. Preeclamptic placentas are characterized by various defects like
Marie-Sophie Fabre et al.
PloS one, 15(4), e0231470-e0231470 (2020-04-23)
The prognosis for people with the high-grade brain tumor glioblastoma is very poor, due largely to low cell death in response to genotoxic therapy. The transcription factor BCL6, a protein that normally suppresses the DNA damage response during immune cell
Andreas Ritter et al.
International journal of molecular sciences, 21(21) (2020-11-14)
Human placentation is a highly invasive process. Deficiency in the invasiveness of trophoblasts is associated with a spectrum of gestational diseases, such as preeclampsia (PE). The oncogene B-cell lymphoma 6 (BCL6) is involved in the migration and invasion of various
Lu Gao et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(10), 3322-3338 (2018-07-22)
Diabetes contributes to cardiovascular complications and the pathogenesis of cardiac remodeling that can lead to heart failure. We aimed to evaluate the functional role of LAZ3 in diabetic cardiomyopathy (DCM). Streptozotocin (STZ) was used to induce a diabetic mouse model.
Siraj M El Jamal et al.
Laboratory investigation; a journal of technical methods and pathology, 99(4), 539-550 (2018-11-18)
Myocyte enhancer-binding factor 2B (MEF2B) has been implicated as a transcriptional regulator for BCL6. However, details about the interaction between MEF2B and BCL6 during expression, as well as the relationship of MEF2B to the expression of other germinal center (GC)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service