Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EHU074691

Sigma-Aldrich

MISSION® esiRNA

targeting human GABPA

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAGTGCACAGAAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAACCAATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGTCTGCAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAACCTGCGGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTTGAAGAAGCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAACAAGTGACAAGATGGGCTGCT

Ensembl | human accession no.

ENSG00000154727

NCBI accession no.

NM_002040

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GABPA(2551) , GABPA(2551)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Limin Xu et al.
Frontiers in cell and developmental biology, 8, 569977-569977 (2020-10-31)
Cerebral ischemic injury is a complicated pathological process. Adipose-derived stromal cells (ADSCs) have been used as a therapeutic strategy, with their therapeutic effects chiefly attributed to paracrine action rather than trans-differentiation. Studies have shown that circAkap7 was found to be
Yanxia Guo et al.
Cell death and differentiation, 27(6), 1862-1877 (2019-12-06)
TERT promoter mutations occur in the majority of glioblastoma, bladder cancer (BC), and other malignancies while the ETS family transcription factors GABPA and its partner GABPB1 activate the mutant TERT promoter and telomerase in these tumors. GABPA depletion or the
Lingjie Bao et al.
Molecular carcinogenesis, 56(6), 1543-1553 (2017-01-24)
Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer
Renzhe Cui et al.
Ophthalmic research, 63(4), 404-412 (2019-12-23)
Oxidative damage plays a vital role in the pathogenesis of age-related macular degeneration (AMD). Exendin-4 (EX4), a glucagon-like peptide-1 receptor agonist, possesses several pharmacological functions, such as anti-inflammatory and antioxidative properties. However, the effects and mechanism of EX4 on oxidative
Yasutaka Mitamura et al.
Oxidative medicine and cellular longevity, 2018, 2475047-2475047 (2018-09-07)
Systemic fibrosing or sclerotic disorders are life-threatening, but only very limited treatment modalities are available for them. In recent years, periostin (POSTN), a major extracellular matrix component, was established by several studies as a novel key player in the progression
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service