Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTCAAAGGGATGTCCTCAGTGTCTGACATCTTTCACTACAAGTATTTCTAACAGTTGCAAGGACACATACACAAACAAATGTTTGACTGGATATGACATTTTAACATTACTATAAGCTTGTTATTTTTTAAGTTTAGCATTGTTAACATTTAAATGACTGAAAGGATGTATATATATCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAGGTTAGGCTTTAAAATAAAGCATGTTATACAGAAGCGATTAGGATTTTTCGCTTGCGAGCAAGGGAGTGTATATACTAAATGCCACACTGTATGTTTCTAACATATTATTATTATTATAAAAAATGTGTGAATATCAGTTTTAGAATAGTTTCTCTGGTGGATGCAATGATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PITX2(5308)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Estefanía Lozano-Velasco et al.
Cardiovascular research, 109(1), 55-66 (2015-08-06)
Atrial fibrillation (AF) is the most common type of arrhythmia in humans, yet the genetic cause of AF remains elusive. Genome-wide association studies (GWASs) have reported risk variants in four distinct genetic loci, and more recently, a meta-GWAS has further
Yu-Hsun Kao et al.
European journal of clinical investigation, 49(10), e13160-e13160 (2019-08-06)
A Pitx2c deficiency increases the risk of atrial fibrillation (AF). Atrial structural remodelling with fibrosis blocks electrical conduction and leads to arrhythmogenesis. A Pitx2c deficiency enhances profibrotic transforming growth factor (TGF)-β expression and calcium dysregulation, suggesting that Pitx2c may play
Wing-Kee Lee et al.
Cancer letters, 449, 237-251 (2019-02-12)
Oncogenic pituitary homeobox 2 (PITX2), a de facto master regulator of developmental organ asymmetry, previously upregulated multidrug resistance (MDR) P-glycoprotein ABCB1 in A498 renal cell carcinoma (RCC) cells. The role of PITX2 isoforms in MDR cancers was investigated. Data mining
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU072181-20UG | 04061831352641 |
| EHU072181-50UG | 04061831372779 |