Skip to Content
Merck
CN

EHU069171

MISSION® esiRNA

targeting human PRKCB

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCAAATGCTCCCTCAACCCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTGTCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCCTTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAGGAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAACTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAGACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACCGATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAACGAAAAGGCACAGATGAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Martina Haller et al.
The Journal of biological chemistry, 291(45), 23557-23568 (2016-09-15)
Dysfunctional mitochondria contribute to the development of many diseases and pathological conditions through the excessive production of reactive oxygen species (ROS), and, where studied, ablation of p66Shc (p66) was beneficial. p66 translocates to the mitochondria and oxidizes cytochrome c to
Jessica Bullenkamp et al.
Apoptosis : an international journal on programmed cell death, 20(6), 831-842 (2015-04-02)
Apoptin, the VP3 protein from chicken anaemia virus (CAV), induces tumour cell-specific cell death and represents a potential future anti-cancer therapeutic. In tumour but not in normal cells, Apoptin is phosphorylated and translocates to the nucleus, enabling its cytotoxic activity.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service