Skip to Content
Merck
CN

EHU069011

MISSION® esiRNA

targeting human CS

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAAGGAAGTTGGCAAAGATGTGTCAGATGAGAAGTTACGAGACTACATCTGGAACACACTCAACTCAGGACGGGTTGTTCCAGGCTATGGCCATGCAGTACTAAGGAAGACTGATCCGCGATATACCTGTCAGCGAGAGTTTGCTCTGAAACACCTGCCTAATGACCCCATGTTTAAGTTGGTTGCTCAGCTGTACAAGATTGTGCCCAATGTCCTCTTAGAGCAGGGTAAAGCCAAGAATCCTTGGCCCAATGTAGATGCTCACAGTGGGGTGCTGCTCCAGTATTATGGCATGACGGAGATGAATTACTACACGGTCCTGTTTGGGGTGTCACGAGCATTGGGTGTACTGGCACAGCTCATCTGGAGCCGAGCCTTAGGCTTCCCTCTAGAAAGGCCCAAGTCCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... CS(1431)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pei-Yao Xu et al.
International journal of nanomedicine, 13, 4685-4698 (2018-08-30)
In recent times, the co-delivery therapeutics have garnered enormous interest from researchers in the treatment of cancers with multidrug resistance (MDR) due to their efficient delivery of multiple agents, which result in synergistic effects and capable of overcoming all the
Ana Vanessa Nascimento et al.
Molecular pharmaceutics, 11(10), 3515-3527 (2014-09-27)
RNA interference has emerged as a powerful strategy in cancer therapy because it allows silencing of specific genes associated with tumor progression and resistance. Mad2 is an essential mitotic checkpoint component required for accurate chromosome segregation during mitosis, and its
Takeshi Nakajima et al.
Investigative ophthalmology & visual science, 55(8), 5278-5283 (2014-07-24)
Activation of calpains (calpain 2 and Lp82) in rodent lenses readily causes proteolysis and cataract formation. In contrast, primate lenses are quite resistant to activation of calpains. The hypothesis is that high levels of human endogenous calpain inhibitor, calpastatin (CS)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service