Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACAAGGACCACCAGTACCAGTTCTTAGAGGATGCAGTGAGGAACCAGCGCAAGCTCCTGGCCTCACTGGTGAAGCGCCTTGGGGACAAACATGCAACATTGCAGAAGAGCACCAAGGAGGTTCGCAGCTCAATCCGCCAGGTGTCTGACGTACAGAAGCGTGTGCAAGTGGATGTCAAGATGGCCATCCTGCAGATCATGAAGGAGCTGAATAAGCGGGGCCGTGTGCTGGTCAATGATGCCCAGAAGGTGACTGAGGGGCAGCAGGAGCGCCTGGAGCGGCAGCACTGGACCATGACCAAGATCCAGAAGCACCAGGAGCACATTCTGCGCTTTGCCTCTTGGGCTCTGGAGAGTGACAACAACACAGCCCTTTTGCTTTCTAAGAAGTTGATCTACTTCCAGCTGCACCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TRIM28(10155)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Min Li et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(38), 23588-23596 (2020-09-10)
In human cells, the DNA replication factor proliferating cell nuclear antigen (PCNA) can be conjugated to either the small ubiquitinlike modifier SUMO1 or SUMO2, but only SUMO2-conjugated PCNA is induced by transcription to facilitate resolution of transcription-replication conflict (TRC). To
Hongtao Liu et al.
Chemico-biological interactions, 311, 108772-108772 (2019-07-28)
Atherosclerosis is a common type of cardiovascular disease (CVD), remaining one of the leading causes of global death. Tripartite motif-containing 28 (TRIM28) is a member of TRIM family that has been found to be involved in atherosclerosis. However, the role
Hitoshi Ohtani et al.
Genome research, 28(8), 1147-1157 (2018-07-05)
We provide a comprehensive genomic and epigenomic map of the more than 500,000 endogenous retroviruses (ERVs) and fragments that populate the intergenic regions of the human genome. The repressive epigenetic marks associated with the ERVs, particularly long terminal repeats (LTRs)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU067331-50UG | 04061828384785 |
| EHU067331-20UG | 04061828617418 |