Skip to Content
Merck
CN

EHU065891

MISSION® esiRNA

targeting human MKI67

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human MKI67

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCCAACAAGCACAAAGCAATGGCCTAAGAGAAGTCTCAGGAAAGCAGATGTAGAGGAAGAATTCTTAGCACTCAGGAAACTAACACCATCAGCAGGGAAAGCCATGCTTACGCCCAAACCAGCAGGAGGTGATGAGAAAGACATTAAAGCATTTATGGGAACTCCAGTGCAGAAACTGGACCTGGCAGGAACTTTACCTGGCAGCAAAAGACAGCTACAGACTCCTAAGGAAAAGGCCCAGGCTCTAGAAGACCTGGCTGGCTTTAAAGAGCTCTTCCAGACTCCTGGTCACACCGAGGAATTAGTGGCTGCTGGTAAAACCACTAAAATACCCTGCGACTCTCCACAGTCAGACCCAGTGGACACCCCAACAAGCACAAAGCAACGACCCAAGAGAAGTATCAGGAAAGCAGATGTAGAGGGAGAACTCTTAGCGTGCAGGAATCTAATGCCATCAGCAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Quim Castellví et al.
Bioelectrochemistry (Amsterdam, Netherlands), 105, 16-24 (2015-05-09)
Delivery of the so-called Tumor Treatment Fields (TTFields) has been proposed as a cancer therapy. These are low magnitude alternating electric fields at frequencies from 100 to 300 kHz which are applied continuously in a non-invasive manner. Electric field delivery
Yusuke Horiuchi et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 19(1), 160-165 (2014-12-11)
The differences in the growth morphology, proliferative ability, and background mucosa of the cancer between Helicobacter pylori (HP)-positive (HP+) gastric cancer (GC) and HP-negative (HP-) GC are still unclear. To clarify the differences, we compared the characteristics of the two
Jianhui Ma et al.
Cancer cell, 35(3), 504-518 (2019-03-05)
Ionizing radiation (IR) and chemotherapy are standard-of-care treatments for glioblastoma (GBM) patients and both result in DNA damage, however, the clinical efficacy is limited due to therapeutic resistance. We identified a mechanism of such resistance mediated by phosphorylation of PTEN
Richard A Byrd et al.
Endocrinology, 156(7), 2417-2428 (2015-04-11)
The tumorigenic potential of dulaglutide was evaluated in rats and transgenic mice. Rats were injected sc twice weekly for 93 weeks with dulaglutide 0, 0.05, 0.5, 1.5, or 5 mg/kg corresponding to 0, 0.5, 7, 20, and 58 times, respectively
John L Vahle et al.
Endocrinology, 156(7), 2409-2416 (2015-04-11)
Glucagon-like peptide-1 (GLP-1) receptor agonists, used for the treatment of type 2 diabetes, have caused hyperplasia/neoplasia of thyroid C cells in rodent carcinogenicity studies. Studies in monkeys have not identified an effect of GLP-1 receptor agonists on thyroid C cells;

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service