Skip to Content
Merck
CN

EHU063551

MISSION® esiRNA

targeting human CUL3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human CUL3

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGATGCACTGCCTTGACAAATCAACGGAAGAACCAATTGTAAAGGTGGTTGAAAGGGAACTCATTTCCAAGCACATGAAGACTATAGTAGAAATGGAGAATTCTGGGCTAGTACATATGTTGAAAAATGGAAAGACAGAAGACCTTGGTTGCATGTACAAGTTATTTAGTCGTGTGCCAAATGGTTTGAAAACAATGTGTGAGTGTATGAGTTCCTATTTGAGGGAGCAAGGTAAAGCTCTTGTTTCTGAAGAAGGAGAAGGAAAGAATCCTGTTGACTATATCCAGGGCTTATTGGATCTGAAGAGTAGGTTCGATCGCTTCCTCCTGGAATCATTCAACAATGACCGTCTCTTTAAACAAACTATTGCGGGTGACTTTGAGTATTTTCTCAACCTCAACTCCAGGTCTCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tomohisa Sakaue et al.
Scientific reports, 7, 42845-42845 (2017-02-22)
Vascular endothelial cell growth factor receptor 2 (VEGFR2) is an essential receptor for the homeostasis of endothelial cells. In this study, we showed that NEDD8-conjugated Cullin3 (CUL3)-based ubiquitin E3 (UbE3) ligase plays a crucial role in VEGFR2 mRNA expression. Human
Tomohisa Sakaue et al.
Cancer science, 108(2), 208-215 (2016-12-18)
Vascular endothelial (VE)-cadherin, a major endothelial adhesion molecule, regulates vascular permeability, and increased vascular permeability has been observed in several cancers. The aim of this study was to elucidate the role of the NEDD8-Cullin E3 ligase, in maintaining barrier permeability.
Ang Luo et al.
Journal of proteome research, 19(1), 260-268 (2019-11-26)
Prolyl hydroxylase domain-containing protein 2 (PHD2/EGLN1) is a key regulatory enzyme that plays a fundamental role in the cellular hypoxic response pathway, mediating proline hydroxylation-dependent protein degradation of selected target proteins. However, the regulation of PHD2 homeostasis at the protein
Alexandros P Drainas et al.
Cell reports, 31(1), 107465-107465 (2020-04-09)
TP53 deficiency is the most common alteration in cancer; however, this alone is typically insufficient to drive tumorigenesis. To identify genes promoting tumorigenesis in combination with TP53 deficiency, we perform genome-wide CRISPR-Cas9 knockout screens coupled with proliferation and transformation assays
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service