Skip to Content
Merck
CN

EHU062641

MISSION® esiRNA

targeting human AQP1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAAGTCACTTCCCCAAGATCTGCCAGACCTGCATGGTCAAGCCTCTTATGGGGGTGTTTCTATCTCTTTCTTTCTCTTTCTGTTTCCTGGCCTCAGAGCTTCCTGGGGACCAAGATTTACCAATTCACCCACTCCCTTGAAGTTGTGGAGGAGGTGAAAGAAAGGGACCCACCTGCTAGTCGCCCCTCAGAGCATGATGGGAGGTGTGCCAGAAAGTCCCCCCTCGCCCCAAAGTTGCTCACCGACTCACCTGCGCAAGTGCCTGGGATTCTACCGTAATTGCTTTGTGCCTTTGGGCACGGCCCTCCTTCTTTTCCTAACATGCACCTTGCTCCCAATGGTGCTTGGAGGGGGAAGAGATCCCAGGAGGTGCAGTGGAGGGGGCAAGCTTTGCTCCTTCAGTTCTGCTTGCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AQP1(358), AQP1(358)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qiang Zhang et al.
Journal of receptor and signal transduction research, 39(2), 146-153 (2019-07-18)
To investigate the effect of miR-223 on thyroid cancer cells, further to study its potential mechanisms. The difference in miR-223 expression between normal thyroid Nthy-ori3-l cells and thyroid cancer SW579 cells was detected by PCR. The miR-223 overexpression and silencing
Hilary S Dorward et al.
Journal of experimental & clinical cancer research : CR, 35, 36-36 (2016-02-26)
Aquaporins (AQP) are water channel proteins that enable fluid fluxes across cell membranes, important for homeostasis of the tissue environment and for cell migration. AQP1 knockout mouse models of human cancers showed marked inhibition of tumor-induced angiogenesis, and in pre-clinical
Yu-Rong Mu et al.
Journal of inflammation research, 13, 701-712 (2020-10-30)
Previous studies have confirmed that aquaporin 1 (AQP1) is up-regulated in synovium of rheumatoid arthritis (RA), but its exact pathogenic mechanisms in RA are unclear. This study revealed the pathogenic role of AQP1 in rat collagen-induced arthritis (CIA) and the
Laura Simone et al.
Journal of cellular and molecular medicine, 22(2), 904-912 (2017-10-19)
Aquaporin-1 (AQP1) is a proangiogenic water channel protein promoting endothelial cell migration. We previously reported that AQP1 silencing by RNA interference reduces angiogenesis-dependent primary tumour growth in a mouse model of melanoma. In this study, we tested the hypothesis that
Hui Luo et al.
Cell and tissue research, 381(3), 543-554 (2020-06-17)
To explore the effects of aquaporin (AQP) 1 on pregnancy outcome and the association between expression of AQP1 and other AQPs in the placenta and foetal membranes, the rate of copulatory plugs and pregnancy, amniotic fluid (AF) volume, osmolality and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service