Skip to Content
Merck
CN

EHU061891

MISSION® esiRNA

targeting human VTCN1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGACCAGGGAGCCAACTTCTCGGAAGTCTCCAATACCAGCTTTGAGCTGAACTCTGAGAATGTGACCATGAAGGTTGTGTCTGTGCTCTACAATGTTACGATCAACAACACATACTCCTGTATGATTGAAAATGACATTGCCAAAGCAACAGGGGATATCAAAGTGACAGAATCGGAGATCAAAAGGCGGAGTCACCTACAGCTGCTAAACTCAAAGGCTTCTCTGTGTGTCTCTTCTTTCTTTGCCATCAGCTGGGCACTTCTGCCTCTCAGCCCTTACCTGATGCTAAAATAATGTGCCTCGGCCACAAAAAAGCATGCAAAGTCATTGTTACAACAGGGATCTACAGAACTATTTCACCACCAGATATGACCTAGTTTTATATTTCTGGGAGGAAATGAATTCATATCTAGAAGTCTGGAGTGAGCAAACAAGAGCAAGAAACAAAAAGAAGCCAAAAGCAGAAGGCTCCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fu-Biao Kang et al.
Oncotarget, 8(46), 80878-80888 (2017-11-09)
B7-H4, another member of costimulatory molecule, has been shown to be overexpressed in multiple types of tumors, including hepatocellular carcinoma (HCC). However, the specific biological role of B7-H4 in HCC still needs to be further explored. In this study, we
Xinran Chen et al.
Cancer science, 107(7), 944-954 (2016-04-19)
B7-H4, one of the costimulatory molecules of the B7 family, has been found to be widely expressed in many kinds of tumor tissues and to play an important part in tumor progression and poor prognosis. However, the role of B7-H4
Xiaochen Hu et al.
Neoplasia (New York, N.Y.), 22(11), 539-553 (2020-09-24)
Trastuzumab is a humanized mAb used to treat HER2-overexpressing breast cancer; however its mechanisms remain to be fully elucidated. Previous studies suggest a role for immunity in mediating trastuzumab-specific antitumor effects. This study evaluated the role(s) of trastuzumab and other
Haoyue Li et al.
Experimental and molecular pathology, 114, 104406-104406 (2020-02-24)
B7-H4 is a member of B7 family which regulates immune responses by delivering costimulatory signals. However, it negatively regulates T cell-mediated immunity and may play an important role in tumor immune evasion. Although several studies have been reported that expression
Ling Wang et al.
Cancer cell international, 18, 100-100 (2018-07-17)
The expression of the immunoregulatory protein B7-H4 has been reported in many types of cancer, including breast cancer. However, its role in triple-negative breast cancer (TNBC), especially its correlation with patients' prognosis and chemoresistance remains unclear. The expression of B7-H4

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service