Skip to Content
Merck
CN

EHU061741

MISSION® esiRNA

targeting human BECN1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGAGAGACTGGATCAGGAGGAAGCTCAGTATCAGAGAGAATACAGTGAATTTAAACGACAGCAGCTGGAGCTGGATGATGAGCTGAAGAGTGTTGAAAACCAGATGCGTTATGCCCAGACGCAGCTGGATAAGCTGAAGAAAACCAACGTCTTTAATGCAACCTTCCACATCTGGCACAGTGGACAGTTTGGCACAATCAATAACTTCAGGCTGGGTCGCCTGCCCAGTGTTCCCGTGGAATGGAATGAGATTAATGCTGCTTGGGGCCAGACTGTGTTGCTGCTCCATGCTCTGGCCAATAAGATGGGTCTGAAATTTCAGAGATACCGACTTGTTCCTTACGGAAACCATTCATATCTGGAGTCTCTGACAGACAAATCTAAGGAGCTGCCGTTATACTGTTCTGGGGGGTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTGGCTTTCCTGGACTGTGTGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jingjing Wu et al.
Journal of cellular and molecular medicine, 22(2), 1190-1201 (2017-10-28)
Long-term peritoneal dialysis is accompanied by functional and histopathological alterations in the peritoneal membrane. In the long process of peritoneal dialysis, high-glucose peritoneal dialysis solution (HGPDS) will aggravate the peritoneal fibrosis, leading to decreased effectiveness of peritoneal dialysis and ultrafiltration
Guangmin Xi et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1610-1616 (2016-11-09)
Multidrug resistance (MDR) is a major obstacle for successful chemotherapy treatment. Searching for effective MDR modulators and combining them with anticancer drug therapies has been a promising strategy against clinical MDR. In our previous study, we have found that DHA-E3
Wenkang Luan et al.
OncoTargets and therapy, 10, 4569-4577 (2017-10-27)
Autophagy is not only a survival response to growth-factor or nutrient deprivation but also an important mechanism for tumor-cell suicide, including melanoma.
Michelle M Coleman et al.
American journal of respiratory cell and molecular biology, 59(5), 548-556 (2018-06-01)
Vitamin A deficiency strongly predicts the risk of developing tuberculosis (TB) in individuals exposed to Mycobacterium tuberculosis (Mtb). The burden of antibiotic-resistant TB is increasing globally; therefore, there is an urgent need to develop host-directed adjunctive therapies to treat TB.
Peiye Song et al.
Journal of experimental & clinical cancer research : CR, 38(1), 354-354 (2019-08-16)
Estrogen receptor β (ERβ) has been reported to play an anti-cancer role in breast cancer, but the regulatory mechanism by which ERβ exerts this effect is not clear. Claudin-6 (CLDN6), a tight junction protein, acts as a tumor suppressor gene

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service