Skip to Content
Merck
CN

EHU059001

MISSION® esiRNA

targeting human DUOXA1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGCTGAATGAGACCATCAATTACAACGAGGAGTTCACCTGGCGCCTGGGTGAGAACTATGCTGAGGAGTATGCAAAGGCTCTGGAGAAGGGGCTGCCAGACCCTGTGTTGTACCTAGCTGAGAAGTTCACTCCAAGAAGCCCATGTGGCCTATACCGCCAGTACCGCCTGGCGGGACACTACACCTCAGCCATGCTATGGGTGGCATTCCTCTGCTGGCTGCTGGCCAATGTGATGCTCTCCATGCCTGTGCTGGTATATGGTGGCTACATGCTATTGGCCACGGGCATCTTCCAGCTGTTGGCTCTGCTCTTCTTCTCCATGGCCACATCACTCACCTCACCCTGTCCCCTGCACCTGGGCGCTTCTGTGCTGCATACTCACCATGGGCCTGCCTTCTGGATCACATTGACCACAGGACTGCTGTGTGTGCTGCTGGGCCTGGCTATGGCGGTGGCCCACAGGATGCAGCCTCACAGGCTGAAGGCTTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zheng Dong et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 7(11), 1903630-1903630 (2020-06-17)
Arsenic (As) is a widespread metalloid contaminant, and its internal exposure is demonstrated to cause serious detrimental health problems. Albeit considerable studies are performed to interrogate the molecular mechanisms responsible for As-induced toxicities, the exact mechanisms are not fully understood
Ning Xiao et al.
Toxicology letters, 292, 97-107 (2018-05-01)
Overexposure to methamphetamine (METH) causes apoptosis in a number of cell types, particularly neuronal cells. However, the underlying mechanisms of METH-induced neuronal apoptosis remain to be elucidated. Accumulation of microtubule-associated protein Tau can lead to activation of multiple neurotoxic pathways
Si-Hao Du et al.
Frontiers in molecular neuroscience, 10, 409-409 (2018-01-10)
Methamphetamine (METH) is an amphetamine-typed stimulant drug that is increasingly being abused worldwide. Previous studies have shown that METH toxicity is systemic, especially targeting dopaminergic neurons in the central nervous system (CNS). However, the role of neuroinflammation in METH neurotoxicity
Lizeng Li et al.
Toxicology research, 7(2), 221-234 (2018-08-10)
Methamphetamine (METH) is well-known as a potent psychostimulant of abuse worldwide. METH administration can cause neurotoxicity and neurodegenerative injury, which are similar to the two prevalent neurodegenerative disorders Alzheimer's disease (AD) and Parkinson's disease (PD). Recent results suggested that METH
Shenghang Jin et al.
Oncology letters, 17(5), 4675-4682 (2019-04-05)
The mechanism responsible for the initiation of tumor metastasis and epithelial-mesenchymal transition (EMT) is not well understood. During EMT, epithelial cells lose their polarity and adhesion to surrounding cells and migrate, resulting in transition into mesenchymal cells. Canonical Wnt signaling

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service