Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGATAAGCACGTTGCAGGAGCTGATGGCAGGGCCTGGGCACTTTAACCCCTACAGGTATGTGGTGGTATCAGTGACCAATGTCATCTGTGCCATTTGCTTTGGCCGGCGCTATGACCACAACCACCAAGAACTGCTTAGCCTAGTCAACCTGAATAATAATTTCGGGGAGGTGGTTGGCTCTGGAAACCCAGCTGACTTCATCCCTATTCTTCGCTACCTACCCAACCCTTCCCTGAATGCCTTCAAGGACCTGAATGAGAAGTTCTACAGCTTCATGCAGAAGATGGTCAAGGAGCACTACAAAACCTTTGAGAAGGGCCACATCCGGGACATCACAGACAGCCTGATTGAGCACTGTCAGGAGAAGCAGCTGGATGAGAACGCCAATGTCCAGCTGTCAGATGAGAAGATCATTAACATCGTCTTGGACCTCTTTGGAGCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CYP1A1(1543)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Marta Vuerich et al.
Journal of hepatology, 74(1), 48-57 (2020-07-15)
In autoimmune hepatitis (AIH), the imbalance between regulatory T cells (Tregs) and T-helper type 17 (Th17) cells has been linked to low levels of CD39, an ectoenzyme that hydrolyses ATP, ultimately generating immunosuppressive adenosine. Upregulation of CD39 results from activation
Hanna Piotrowska-Kempisty et al.
Toxicology letters, 267, 59-66 (2017-01-04)
The role of CYP1A1 and CYP1B1 enzymes in the biotransformation and biological activity of the methylated resveratrol analogue, 3,4,5,4'-tetramethoxystilbene (DMU-212) is still elusive. Our recently published data have shown that one of the metabolites of DMU-212, 3'-hydroxy-3,4,5,4'-tetramethoxystilbene (DMU-214) exerts more
Laura MacPherson et al.
International journal of molecular sciences, 15(5), 7939-7957 (2014-05-09)
The aryl hydrocarbon receptor (AHR) regulates the toxic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The AHR repressor (AHRR) is an AHR target gene and functions as a ligand-induced repressor of AHR; however, its mechanism of inhibition is controversial. Recently, we reported that
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU058161-50UG | 04061828325450 |
| EHU058161-20UG | 04061828560608 |