Skip to Content
Merck
CN

EHU058031

MISSION® esiRNA

targeting human KCNK2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAAGACGGTCTCCACGATATTCCTGGTGGTTGTCCTCTATCTGATCATCGGAGCCACCGTGTTCAAAGCATTGGAGCAGCCTCATGAGATTTCACAGAGGACCACCATTGTGATCCAGAAGCAAACATTCATATCCCAACATTCCTGTGTCAATTCGACGGAGCTGGATGAACTCATTCAGCAAATAGTGGCAGCAATAAATGCAGGGATTATACCGTTAGGAAACACCTCCAATCAAATCAGTCACTGGGATTTGGGAAGTTCCTTCTTCTTTGCTGGCACTGTTATTACAACCATAGGATTTGGAAACATCTCACCACGCACAGAAGGCGGCAAAATATTCTGTATCATCTATGCCTTACTGGGAATTCCCCTCTTTGGTTTTCTCTTGGCTGGAGTTGGAGATCAGCTAGGCACCATATTTGGAAAAGGAATTGCCAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... KCNK2(3776)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Oleg Yarishkin et al.
Investigative ophthalmology & visual science, 60(6), 2294-2303 (2019-05-23)
The concentration of protons in the aqueous humor (AH) of the vertebrate eye is maintained close to blood pH; however, pathologic conditions and surgery may shift it by orders of magnitude. We investigated whether and how changes in extra- and
Ricardo H Pineda et al.
American journal of physiology. Renal physiology, 313(2), F535-F546 (2017-05-26)
Detrusor overactivity (DO) is the abnormal response of the urinary bladder to physiological stretch during the filling phase of the micturition cycle. The mechanisms of bladder smooth muscle compliance upon the wall stretch are poorly understood. We previously reported that
Junsung Woo et al.
The Journal of physiology, 598(20), 4555-4572 (2020-07-25)
Neuronal activity causes astrocytic volume change via K+ uptake through TREK-1 containing two-pore domain potassium channels. The volume transient is terminated by Cl- efflux through the Ca2+ -activated anion channel BEST1. The source of the Ca2+ required to open BEST1
Haiyun Guo et al.
BMC anesthesiology, 17(1), 124-124 (2017-09-06)
There are growing concerns that anaesthetic exposure can cause extensive apoptotic degeneration of neurons and the impairment of normal synaptic development and remodelling. However, little attention has been paid to exploring the possible cytotoxicity of inhalation anaesthetics, such as isoflurane

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service