Skip to Content
Merck
CN

EHU056051

MISSION® esiRNA

targeting human SPTA1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTGTTGCCTCTGAAGGACTGTTTCACAGTCACAAGGGACTTGAGAGAAATCTTGCTGTCATGAGTGACAAGGTGAAGGAGTTATGTGCTAAAGCAGAGAAGCTGACACTTTCCCATCCTTCAGATGCACCTCAGATCCAGGAGATGAAAGAAGATCTGGTCTCCAGCTGGGAGCATATTCGTGCCCTGGCCACCAGCAGATATGAAAAACTGCAGGCTACTTATTGGTACCATCGATTTTCATCTGACTTTGATGAACTCTCAGGCTGGATGAACGAGAAGACTGCTGCGATCAATGCTGATGAGCTGCCAACAGATGTGGCTGGTGGAGAAGTTCTGCTGGACAGGCATCAGCAGCATAAGCATGAGATTGACTCTTACGATGACCGATTTCAATCTGCTGATGAGACTGGTCAAGACCTCGTGAATGCCAATCATGAAGCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yunze Xu et al.
Oncotarget, 7(3), 3233-3244 (2015-12-18)
Adrenocortical carcinoma (ACC) is a rare endocrine tumor with a very poor prognosis. Sphingosine kinase 1 (SphK1), an oncogenic kinase, has previously been found to be upregulated in various cancers. However, the role of the SphK1 in ACC has not
Evgeny V Berdyshev et al.
PloS one, 6(1), e16571-e16571 (2011-02-10)
Earlier we have shown that extracellular sphingosine-1-phosphate (S1P) induces migration of human pulmonary artery endothelial cells (HPAECs) through the activation of S1P(1) receptor, PKCε, and PLD2-PKCζ-Rac1 signaling cascade. As endothelial cells generate intracellular S1P, here we have investigated the role
N C Hait et al.
Oncogenesis, 4, e156-e156 (2015-06-09)
Estrogen receptor-α (ERα)-negative breast cancer is clinically aggressive and does not respond to conventional hormonal therapies. Strategies that lead to re-expression of ERα could sensitize ERα-negative breast cancers to selective ER modulators. FTY720 (fingolimod, Gilenya), a sphingosine analog, is the
T H Beckham et al.
Oncogenesis, 2, e49-e49 (2013-06-05)
Acid ceramidase (AC) is overexpressed in most prostate tumors and confers oncogenic phenotypes to prostate cancer cells. AC modulates the cellular balance between ceramide, sphingosine and sphingosine 1-phosphate (S1P). These bioactive sphingolipids have diverse, powerful and often oppositional impacts on
Panfeng Fu et al.
The Journal of biological chemistry, 291(53), 27187-27203 (2016-11-20)
Hepatocyte growth factor (HGF) signaling via c-Met is known to promote endothelial cell motility and angiogenesis. We have previously reported that HGF stimulates lamellipodia formation and motility of human lung microvascular endothelial cells (HLMVECs) via PI3K/Akt signal transduction and reactive

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service