Skip to Content
Merck
CN

EHU053891

MISSION® esiRNA

targeting human TET1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAAGACCTCCAAGACCCAAACTTACAGGGAGAGCCACCAAAACTTAATCACTGTCCATCTTTGGAAAAACAAAGTTCATGCAACACGGTGGTTTTCAATGGGCAAACTACTACCCTTTCCAACTCACATATCAACTCAGCTACTAACCAAGCATCCACAAAGTCACATGAATATTCAAAAGTCACAAATTCATTATCTCTTTTTATACCAAAATCAAATTCATCCAAGATTGACACCAATAAAAGTATTGCTCAAGGGATAATTACTCTTGACAATTGTTCCAATGATTTGCATCAGTTGCCACCAAGAAATAATGAAGTGGAGTATTGCAACCAGTTACTGGACAGCAGCAAAAAATTGGACTCAGATGATCTATCATGTCAGGATGCAACCCATACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Piotr T Filipczak et al.
Cancer research, 79(8), 1758-1768 (2019-01-10)
The role of transcriptional regulator ten-eleven translocation methylcytosine dioxygenease 1 (TET1) has not been well characterized in lung cancer. Here we show that TET1 is overexpressed in adenocarcinoma and squamous cell carcinomas. TET1 knockdown reduced cell growth in vitro and
Li Gao et al.
International journal of biological sciences, 16(8), 1324-1334 (2020-03-27)
Myostatin (MSTN) is mostly expressed in skeletal muscle and plays crucial roles in the negative regulation of muscle mass development. The methylation and demethylation of myogenesis-specific genes are major regulatory factors in muscle satellite cell differentiation. The present study was
Pankaj Prasad et al.
Stem cells (Dayton, Ohio), 35(6), 1468-1478 (2017-04-05)
Activation of pluripotency regulatory circuit is an important event in solid tumor progression and the hypoxic microenvironment is known to enhance the stemness feature of some cells. The distinct population of cancer stem cells (CSCs)/tumor initiating cells exist in a
Xiaoli Peng et al.
BMC cancer, 17(1), 619-619 (2017-09-06)
Breast cancer is the common cancer in China. In previous study, we determined that 3,6-dihydroxyflavone (3,6-DHF) increases miR-34a significantly in breast carcinogenesis, but the mechanism remains unclear. We used qRT-PCR to analyze miR-34a and ten-eleven translocation (TET)1, TET2, TET3 levels
Chuanxu Wang et al.
Cancer medicine, 8(3), 990-1003 (2019-02-21)
Increasing evidence revealed that ten-eleven translocation 1 (TET1) plays an important role in tumorigenesis and chemoresistance, but its functions in gemcitabine resistance in cholangiocarcinoma (CCA) remain unknown. This study aims to investigate the effect of TET1 on gemcitabine resistance in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service