Skip to Content
Merck
CN
All Photos(1)

Key Documents

Safety Information

EHU050931

Sigma-Aldrich

MISSION® esiRNA

targeting human CD14

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCGCTGTGTAGGAAAGAAGCTAAAGCACTTCCAGAGCCTGTCCGGAGCTCAGAGGTTCGGAAGACTTATCGACCATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACCACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAACCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCATGCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGGCAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAGGTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAACTGACGCTCGAGGACCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mai Fujikura et al.
Journal of Alzheimer's disease : JAD, 68(1), 323-337 (2019-02-19)
We previously demonstrated that microglia play an essential role in clearance of amyloid-β (Aβ) in Alzheimer's disease (AD)-like pathology. Our prior work also showed that several receptors expressed on microglia participated in Aβ phagocytosis. However, clathrin-mediated endocytosis (CME), which is
Nathalie Bonello-Palot et al.
Atherosclerosis, 237(1), 45-52 (2014-09-10)
Defects in lamin A maturation result in premature aging syndromes and severe atherosclerosis as observed in the Hutchinson-Gilford Progeria Syndrome. In age-related atherosclerosis, several features of cellular senescence have been characterized in endothelial cells including telomere shortening and increased oxidative
Elena M V de Cavanagh et al.
American journal of physiology. Heart and circulatory physiology, 307(2), H207-H215 (2014-05-27)
Early endothelial progenitor cells (early EPC) and late EPC are involved in endothelial repair and can rescue damaged endothelial cells by transferring organelles through tunneling nanotubes (TNT). In rodents, EPC mobilization from the bone marrow depends on sympathetic nervous system

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service