Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GATGACTGCTAAGGGGTGGAACTTGAACCAGTTGCAGTTCCCACCCAGTATTCATTTCTGCATCACATTACTACACGCCCGGAAACGAGTAGCTATACAATTCCTAAAGGACATTCGAGAATCTGTCACTCAAATCATGAAGAATCCTAAAGCGAAGACCACAGGAATGGGTGCCATCTATGGCATGGCCCAGACAACTGTTGACAGGAATATGGTTGCAGAATTGTCCTCAGTCTTCTTGGACAGCTTGTACAGCACCGACACTGTCACCCAGGGCAGCCAGATGAATGGTTCTCCAAAACCCCACTGAACTTGGACCCTTTCTAGTCTCAAGGGGATTCCAGCCTTCAGAAGGTTCTTGGGATATGGAACAGGCCGTGCACAACTTTGACATCTGGTCTTGCTCCATAGAGCACAACTCAAGATAGACCATGAGACAGCTTGAGCCTCAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SGPL1(8879)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yuxuan Zhen et al.
Journal of autoimmunity, 93, 37-44 (2018-06-14)
Glomerulonephritis (GN) is a typical lesion in autoantibody and immune complex disorders, including SLE. Because the Gas6/Axl pathway has been implicated in the pathogenesis of many types of GN, targeting this pathway might ameliorate GN. Consequently, we have studied the
Haifei Wang et al.
Genes & genetic systems, 93(5), 191-198 (2018-11-27)
DNA methylation is an important mediator of gene expression regulation and has been shown to be closely linked to aging. Immune-related genes tend to be influenced by DNA methylation at different ages. To explore DNA methylation changes in the porcine
Pan-Feng Feng et al.
Molecular pharmaceutics, 16(4), 1477-1488 (2019-02-27)
The hERG potassium channel (IKr) encoded by human ether-a-go-go-related gene plays an important role in cardiac repolarization. Decreased IKr may lead to long QT syndrome, which subsequently causes torsade de pointes and sudden cardiac death. Previous studies have shown that
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU050501-50UG | 04061831371895 |
| EHU050501-20UG | 04061828571697 |