Skip to Content
Merck
CN

EHU049751

MISSION® esiRNA

targeting human FEM1B

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGATAAAATGGCGTGCTGCTATAGTAGTGAATGGCCATGGGATGACGCCATTGAAAGTAGCTGCCGAAAGCTGTAAAGCTGATGTCGTAGAACTGTTACTCTCTCATGCTGATTGCGACCGAAGAAGTCGGATTGAAGCTTTGGAACTCTTGGGTGCCTCCTTTGCAAATGACCGTGAGAACTATGACATCATAAAGACATACCACTATCTATATTTAGCCATGTTAGAGAGGTTCCAAGATGGTGATAACATTCTCGAAAAAGAGGTTCTTCCACCAATCCATGCTTATGGGAATAGAACTGAATGTAGAAATCCTCAGGAACTGGAGTCCATTCGGCAAGACAGAGATGCTCTTCATATGGAAGGCCTTATAGTTCGGGAACGGATTTTAGGTGCTGACAATATTGATGTTTCTCATCCCATCATTTACAGAGGAGCTGTTTATGCGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

John F Dankert et al.
Cell cycle (Georgetown, Tex.), 16(6), 556-564 (2017-01-25)
FEM1A, FEM1B, and FEM1C are evolutionarily-conserved VHL-box proteins, the substrate recognition subunits of CUL2-RING E3 ubiquitin ligase complexes. Here, we report that FEM1 proteins are ancient regulators of Stem-Loop Binding Protein (SLBP), a conserved protein that interacts with the stem
Keiichi Tamai et al.
Scientific reports, 10(1), 21592-21592 (2020-12-11)
Cancer stem cells (CSCs) define a subpopulation of cancer cells that are resistant to therapy. However, little is known of how CSC characteristics are regulated. We previously showed that dormant cancer stem cells are enriched with a CD274low fraction of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service