Skip to Content
Merck
CN
All Photos(1)

Key Documents

Safety Information

EHU047601

Sigma-Aldrich

MISSION® esiRNA

targeting human MCPH1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAAATCTTTCCCCCACCTCTTCCCAAATGATTCAGCAGTCTCATGATAATCCAAGTAACTCTCTGTGTGAAGCACCTTTGAACATTTCACGTGATACTTTGTGTTCAGATGAATACTTTGCTGGTGGCTTACACTCATCTTTTGATGATCTTTGTGGAAACTCAGGATGTGGAAATCAGGAAAGGAAGTTGGAAGGATCCATTAATGACATTAAAAGTGATGTGTGTATTTCTTCACTTGTATTGAAAGCAAATAATATTCATTCATCACCATCTTTCACTCACCTCGATAAATCAAGTCCTCAGAAATTTCTGAGTAATCTTTCAAAGGAAGAAATAAACTTGCAAAGAAATATTGCAGGTAAAGTAGTCACCCCTGACCAAAAGCAGGCTGCAGGTATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

María Arroyo et al.
Genes, 11(4) (2020-04-12)
The capacity of Topoisomerase II (Topo II) to remove DNA catenations that arise after replication is essential to ensure faithful chromosome segregation. Topo II activity is monitored during G2 by a specific checkpoint pathway that delays entry into mitosis until
Alessandro Cicconi et al.
Nature communications, 11(1), 5861-5861 (2020-11-19)
Telomeres protect chromosome ends from inappropriately activating the DNA damage and repair responses. Primary microcephaly is a key clinical feature of several human telomere disorder syndromes, but how microcephaly is linked to dysfunctional telomeres is not known. Here, we show
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service