Skip to Content
Merck
CN
All Photos(1)

Key Documents

Safety Information

EHU042361

Sigma-Aldrich

MISSION® esiRNA

targeting human STC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCAGGGAAAAGCATTCGTCAAAGAGAGCTTAAAATGCATCGCCAACGGGGTCACCTCCAAGGTCTTCCTCGCCATTCGGAGGTGCTCCACTTTCCAAAGGATGATTGCTGAGGTGCAGGAAGAGTGCTACAGCAAGCTGAATGTGTGCAGCATCGCCAAGCGGAACCCTGAAGCCATCACTGAGGTCGTCCAGCTGCCCAATCACTTCTCCAACAGATACTATAACAGACTTGTCCGAAGCCTGCTGGAATGTGATGAAGACACAGTCAGCACAATCAGAGACAGCCTGATGGAGAAAATTGGGCCTAACATGGCCAGCCTCTTCCACATCCTGCAGACAGACCACTGTGCCCAAACACACCCACGAGCTGACTTCAACAGGAGACGCACCAATGAGCCGCAGAAGCTGAAAGTCCTCCTCAGGAACCTCCGAGGTGAGGAGGACTCTCCCTCCCACATCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fei Zhao et al.
Oxidative medicine and cellular longevity, 2020, 1898213-1898213 (2020-04-23)
Contrast-induced acute kidney injury (CI-AKI) is the third common cause of acute kidney injury (AKI), which is associated with poor short- and long-term outcomes. Currently, effective therapy strategy for CI-AKI remains lacking. Stanniocalcin-1 (STC1) is a conserved glycoprotein with antiapoptosis
Wenru Su et al.
Journal of molecular cell biology, 9(4), 289-301 (2017-06-29)
Mesenchymal stem cells (MSCs) have been demonstrated to have promising therapeutic benefits for a variety of neurological diseases; however, the underlying mechanisms are poorly understood. Here, we showed that intravitreal infusion of MSCs promoted retinal ganglion cell (RGC) survival in
Yin-Bo Niu et al.
Acta pharmacologica Sinica, 41(11), 1476-1486 (2020-09-17)
Recent studies demonstrate that diet quercetin (Quer) has obvious bone protective effects on ovariectomized rodents but thus far there is no direct evidence to support the inhibitory effect of Quer on bone loss caused by long-term unloading. In the present
Dong Dai et al.
Oncology reports, 35(1), 552-558 (2015-11-05)
The new anti-aging gene Klotho has been identified as a multi-functional humoral factor which influences multiple biological processes, including tumor progression. Although ample evidence indicates that Klotho plays important roles in cervical, lung and breast cancer, the role and mechanism
Huai-Bin Hu et al.
Nature communications, 12(1), 662-662 (2021-01-30)
Dynamic assembly and disassembly of primary cilia controls embryonic development and tissue homeostasis. Dysregulation of ciliogenesis causes human developmental diseases termed ciliopathies. Cell-intrinsic regulatory mechanisms of cilia disassembly have been well-studied. The extracellular cues controlling cilia disassembly remain elusive, however.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service