Skip to Content
Merck
CN

EHU039481

MISSION® esiRNA

targeting human CLTC

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGATCAGGGACAGCAGTTTGCCCAAATGTTAGTTCAAGATGAAGAGCCTCTTGCTGACATCACACAGATTGTAGATGTCTTTATGGAATACAATCTAATTCAGCAGTGTACTGCATTCTTGCTTGATGCTCTGAAGAATAATCGCCCATCTGAAGGTCCTTTACAGACGCGGTTACTTGAGATGAACCTTATGCATGCGCCTCAAGTTGCAGATGCTATTCTAGGCAATCAGATGTTCACACATTATGACCGGGCTCATATTGCTCAACTGTGTGAAAAGGCTGGCCTACTGCAGCGTGCATTAGAACATTTCACTGATTTATATGATATAAAACGTGCAGTGGTTCACACCCATCTTCTTAACCCTGAGTGGTTAGTCAACTACTTTGGTTCCTTATCAGTAGAAGACTCCCTAGAATGTCTCAGAGCCATGCTGTCTGCCAACATCCGTCAGAATCTGCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhenzhu Jiang et al.
Anti-cancer drugs, 32(1), 1-10 (2020-09-16)
Circular RNAs are involved in the occurrence and development of different types of cancers. We aimed to illustrate the expression profile and mechanism of circ_0074027 in non-small cell lung cancer (NSCLC). Quantitative real-time PCR was employed to detect the expression
Min Feng et al.
Virus research, 253, 12-19 (2018-05-29)
Bombyx mori nucleopolyhedrovirus (BmNPV) is a leading cause of silkworm mortality and economic loss to sericulture. The entry of BmNPV budded virus (BV) into host cells is a fundamental process required for the initiation of infection. However, our understanding of
Jiao Liu et al.
Science signaling, 12(585) (2019-06-13)
Transient receptor potential vanilloid 1 (TRPV1), a nonselective, ligand-gated cation channel, responds to multiple noxious stimuli and is targeted by many kinases that influence its trafficking and activity. Studies on the internalization of TRPV1 have mainly focused on that induced
Lei Miao et al.
Nature communications, 11(1), 2424-2424 (2020-05-18)
Lipid-like nanoparticles (LNPs) have potential as non-viral delivery systems for mRNA therapies. However, repeated administrations of LNPs may lead to accumulation of delivery materials and associated toxicity. To address this challenge, we have developed biodegradable lipids which improve LNPs clearance
Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service