Skip to Content
Merck
CN

EHU038491

MISSION® esiRNA

targeting human MUC13

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCACCACAGAAGACAATCAATCATCAGGGCCTCCCACTGGCACCGCTTTATTGGAGACCAGCACCCTAAACAGCACAGGTCCCAGCAATCCTTGCCAAGATGATCCCTGTGCAGATAATTCGTTATGTGTTAAGCTGCATAATACAAGTTTTTGCCTGTGTTTAGAAGGGTATTACTACAACTCTTCTACATGTAAGAAAGGAAAGGTATTCCCTGGGAAGATTTCAGTGACAGTATCAGAAACATTTGACCCAGAAGAGAAACATTCCATGGCCTATCAAGACTTGCATAGTGAAATTACTAGCTTGTTTAAAGATGTATTTGGCACATCTGTTTATGGACAGACTGTAATTCTTACTGTAAGCACATCTCTGTCACCAAGATCTGAAATGCGTGCTGATGACAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Andrew E Massey et al.
Micron (Oxford, England : 1993), 130, 102822-102822 (2020-01-14)
Pancreatic cancer is one of the most lethal cancers in the United States. This is partly due to the difficulty in early detection of this disease as well as poor therapeutic responses to currently available regimens. Our previous reports suggest
Hui Wang et al.
Journal of cancer research and therapeutics, 11 Suppl 1, C74-C79 (2015-09-02)
Mucin 13 (MUC13) and Mucin 20 (MUC20) are high molecular weight transmembrane O-linked glycoprotein secreted by epithelium and are widely overexpressed in epithelial tumor cells. Previously, it has been reported that MUC13 and MUC20 were prognostic molecular biomarkers of some
Sheema Khan et al.
Oncotarget, 5(17), 7599-7609 (2014-10-04)
Pancreatic cancer has a poor prognosis due to late diagnosis and ineffective therapeutic multimodality. MUC13, a transmembrane mucin is highly involved in pancreatic cancer progression. Thus, understanding its regulatory molecular mechanisms may offer new avenue of therapy for prevention/treatment of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service