Skip to Content
Merck
CN

EHU035131

MISSION® esiRNA

targeting human KLF5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACACACATCAAGACAGAACCTGTTGCCATTTTCAGCCACCAGAGTGAAACGACTGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCTGAGTTCACCAGTATATTCAGCTCACACCAGACCGCAGCTCCAGAGGTGAACAATATTTTCATCAAACAAGAACTTCCTACACCAGATCTTCATCTTTCTGTCCCTACCCAGCAGGGCCACCTGTACCAGCTACTGAATACACCGGATCTAGATATGCCCAGTTCTACAAATCAGACAGCAGCAATGGACACTCTTAATGTTTCTATGTCAGCTGCCATGGCAGGCCTTAACACACACACCTCTGCTGTTCCGCAGACTGCAGTGAAACAATTCCAGGGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

P Chen et al.
European review for medical and pharmacological sciences, 24(8), 4224-4231 (2020-05-07)
This study aims to investigate the expression characteristics of Krüppel-like factor 5 (KLF5) in gastric cancer (GC) and its potential correlation to pathological indexes in GC patients. Molecular mechanisms underlying the regulatory effect of KLF5 on GC progression are explored.
Qiu-Yu Wang et al.
Molecular oncology, 14(9), 2203-2230 (2020-05-28)
Long noncoding RNAs (lncRNAs) have important regulatory roles in cancer biology. Although some lncRNAs have well-characterized functions, the vast majority of this class of molecules remains functionally uncharacterized. To systematically pinpoint functional lncRNAs, a computational approach was proposed for identification
Kaixin Wangzhou et al.
Frontiers in physiology, 11, 606967-606967 (2021-02-20)
Human periodontal ligament cells (hPDLCs) play a vital role in cell regeneration and tissue repair with multi-directional differentiation potential. microRNAs (miRs) are implicated in the osteogenesis of hPDLCs. This study explored the mechanism of miR-143-3p in osteogenesis of hPDLCs. Osteogenic
Yan-Yi Jiang et al.
Gastroenterology, 159(4), 1311-1327 (2020-07-04)
We investigated the transcriptome of esophageal squamous cell carcinoma (ESCC) cells, activity of gene regulatory (enhancer and promoter regions), and the effects of blocking epigenetic regulatory proteins. We performed chromatin immunoprecipitation sequencing with antibodies against H3K4me1, H3K4me3, and H3K27ac and
Liyuan Gao et al.
Life sciences, 264, 118696-118696 (2020-11-07)
Liver fibrosis is a difficult problem in the medical field. We previously reported that curcumol, a bioactive substance, may inhibit the pathological angiogenesis of liver sinusoidal endothelial cells (LSECs) and play a good anti-hepatic fibrosis effect. However, the mechanism of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service