Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EHU035111

Sigma-Aldrich

MISSION® esiRNA

targeting human PHGDH

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCATCAACGCAGCTGAGAAACTCCAGGTGGTGGGCAGGGCTGGCACAGGTGTGGACAATGTGGATCTGGAGGCCGCAACAAGGAAGGGCATCTTGGTTATGAACACCCCCAATGGGAACAGCCTCAGTGCCGCAGAACTCACTTGTGGAATGATCATGTGCCTGGCCAGGCAGATTCCCCAGGCGACGGCTTCGATGAAGGACGGCAAATGGGAGCGGAAGAAGTTCATGGGAACAGAGCTGAATGGAAAGACCCTGGGAATTCTTGGCCTGGGCAGGATTGGGAGAGAGGTAGCTACCCGGATGCAGTCCTTTGGGATGAAGACTATAGGGTATGACCCCATCATTTCCCCAGAGGTCTCGGCCTCCTTTGGTGTTCAGCAGCTGCCCCTGGAGGAGATCTGGCCTCTCTGTGATTTCATCACTGTGCACACTCCTCTCCTGCCCTCCACGACAGGCTTGCTGAATGACA

Ensembl | human accession no.

ENSG00000092621

NCBI accession no.

NM_006623

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PHGDH(26227) , PHGDH(26227)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wen-Bin Guo et al.
Reproductive biology and endocrinology : RB&E, 18(1), 70-70 (2020-07-16)
Although varicocele is considered to be one of the leading causes of male infertility, the precise mechanism underlying how varicocele leads to male infertility is not completely understood. We found the lactate concentration on the varicocele side of the patients
Mai Q Nguyen et al.
The Journal of investigative dermatology, 140(11), 2242-2252 (2020-05-12)
Melanomas frequently harbor activating NRAS mutations leading to activation of MAPK kinase (MEK) and extracellular signal-regulated kinase 1/2 signaling; however, the clinical efficacy of inhibitors to this pathway is limited by resistance. Tumors rewire metabolic pathways in response to stress
Florence Polet et al.
Oncotarget, 7(2), 1765-1776 (2015-12-02)
Leukemia cells are described as a prototype of glucose-consuming cells with a high turnover rate. The role of glutamine in fueling the tricarboxylic acid cycle of leukemia cells was however recently identified confirming its status of major anaplerotic precursor in
Stephanie Metcalf et al.
Clinical & experimental metastasis, 37(1), 187-197 (2019-10-21)
Breast cancer is the second leading cause of cancer-related deaths among women and 90% of these mortalities can be attributed to progression to metastatic disease. In particular, triple negative breast cancer (TNBC) is extremely aggressive and frequently metastasizes to multiple
Amit Subedi et al.
FEBS letters, 593(8), 763-776 (2019-03-16)
Differences in the metabolism of cancer cells or cancer stem cells (CSCs) as compared to normal cells have provided avenues to safely target cancers. To discover metabolic inhibitors of CSCs, we performed alkaline phosphatase- and tumoursphere-based drug screening using induced
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service