Skip to Content
Merck
CN

EHU034291

MISSION® esiRNA

targeting human FOS

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human FOS

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCAT

Ensembl | human accession no.

ENSG00000170345

NCBI accession no.

NM_005252

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... FOS(2353), FOS(2353)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
MSS
DIS
ZOR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yahui Zhao et al.
The Journal of biological chemistry, 291(13), 6831-6842 (2016-02-10)
ID1 (inhibitor of differentiation/DNA binding 1) acts an important role in metastasis, tumorigenesis, and maintenance of cell viability. It has been shown that the up-regulation of ID1 is correlated with poor prognosis and the resistance to chemotherapy of human cancers.
Peipei Jin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1212-1219 (2016-10-25)
Interleukin-1 receptor-associated kinase M (IRAK-M) is a well-known negative regulator for Toll-like receptor signaling, which can regulate immune homeostasis and tolerance in a number of pathological settings. However, the mechanism for IRAK-M regulation at transcriptional level remains largely unknown. In
Lianjie Hou et al.
Cells, 8(6) (2019-06-20)
Skeletal muscle plays an essential role in maintaining body energy homeostasis and body flexibility. Loss of muscle mass leads to slower wound healing and recovery from illness, physical disability, poor quality of life, and higher health care costs. So, it
Li Lin et al.
Journal of cellular physiology, 234(10), 18928-18941 (2019-04-21)
Pre-eclampsia (PE) is a serious hypertensive disorder of pregnancy that remains a leading cause of perinatal and maternal morbidity and mortality worldwide. Placental ischemia/hypoxia and the secretion of soluble fms-like tyrosine kinase 1 (sFlt1) into maternal circulation are involved in
Ningbo Zheng et al.
International journal of medical microbiology : IJMM, 309(8), 151340-151340 (2019-09-09)
Chlamydia pneumoniae (C. pneumoniae) infection is associated with the initiation and progression of atherosclerosis. The migration of vascular smooth muscle cell (VSMC) from the media to the intima is a key event in the development of atherosclerosis. Interleukin-17C (IL-17C) could
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service