Skip to Content
Merck
CN

EHU033441

MISSION® esiRNA

targeting human XPC

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTTTCAATAAAGGGGTCCATGAGGACACACACAAGGTTCACCTTCTCTGCCTGCTAGCAAATGGCTTCTATCGAAATAACATCTGCAGCCAGCCAGATCTGCATGCTATTGGCCTGTCCATCATCCCAGCCCGCTTTACCAGAGTGCTGCCTCGAGATGTGGACACCTACTACCTCTCAAACCTGGTGAAGTGGTTCATTGGAACATTTACAGTTAATGCAGAACTTTCAGCCAGTGAACAAGATAACCTGCAGACTACATTGGAAAGGAGATTTGCTATTTACTCTGCTCGAGATGATGAGGAATTGGTCCATATATTCTTACTGATTCTCCGGGCTCTGCAGCTCTTGACCCGGCTGGTATTGTCTCTACAGCCAATTCCTCTGAAGTCAGCAACAGCAAAGGGAAAGA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Timothy Budden et al.
BMC cancer, 18(1), 100-100 (2018-01-28)
Melanoma has two key features, an over-representation of UV-induced mutations and resistance to DNA damaging chemotherapy agents. Both of these features may result from dysfunction of the nucleotide excision repair pathway, in particular the DNA damage detection branch, global genome
Jyh-Cheng Chen et al.
Toxicology research, 7(6), 1247-1256 (2018-12-18)
Astaxanthin has been demonstrated to exhibit a wide range of beneficial effects that include anti-cancer and anti-inflammatory properties. Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair and is involved in
Hiroyuki Niida et al.
Nature communications, 8, 16102-16102 (2017-07-19)
HBO1, a histone acetyl transferase, is a co-activator of DNA pre-replication complex formation. We recently reported that HBO1 is phosphorylated by ATM and/or ATR and binds to DDB2 after ultraviolet irradiation. Here, we show that phosphorylated HBO1 at cyclobutane pyrimidine
Jyh-Cheng Chen et al.
Pharmacology, 102(1-2), 91-104 (2018-06-29)
Etoposide (VP16) is a topoisomerase II inhibitor and has been used for the treatment of non-small cell lung cancer (NSCLC). Xeroderma pigmentosum complementation group C (XPC) protein is a DNA damage recognition factor in nucleotide excision repair and involved in
Tiantian Cui et al.
Oncotarget, 6(12), 10060-10072 (2015-04-15)
Xeroderma pigmentosum complementation group C (XPC) protein is an important DNA damage recognition factor in nucleotide excision repair. Deletion of XPC is associated with early stages of human lung carcinogenesis, and reduced XPC mRNA levels predict poor patient outcome for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service