Skip to Content
Merck
CN
All Photos(1)

Key Documents

Safety Information

EHU032631

Sigma-Aldrich

MISSION® esiRNA

targeting human DCTN4

Sign Into View Organizational & Contract Pricing

Select a Size

1 ML
CN¥4,143.87

CN¥4,143.87

Estimated to ship onJune 24, 2025Details

All Photos(1)

Select a Size

Change View
1 ML
CN¥4,143.87

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

CN¥4,143.87

Estimated to ship onJune 24, 2025Details

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAGAAACTGGCACGACGTAGAAACTATATGCCTCTGGCTTTTTCGGACAAATATGGTCTTGGAACCAGGCTTCAGCGACCACGAGCTGGTGCATCCATCAGTACCCTTGCCGGACTTTCCCTTAAAGAAGGAGAGGATCAGAAAGAGATAAAGATTGAGCCAGCTCAGGCTGTGGATGAAGTGGAACCTCTACCTGAAGACTATTATACAAGACCAGTAAATTTAACAGAGGTAACAACCCTTCAGCAGCGTCTGTTACAGCCTGACTTCCAGCCAGTCTGTGCTTCACAGCTCTATCCTCGCCACAAACATCTTCTGATCAAACGGTCCCTGCGCTGCCGTAAATGTGAACATAATTTGAGCAAGCCAGAATTTAACCCAACGTCAATCAAATTCAAAATCCAGCTGGTCG

Ensembl | human accession no.

ENSG00000132912

NCBI accession no.

NM_016221

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DCTN4(51164) , DCTN4(51164)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
  • Specification Sheet

    • Choose from one of the most recent versions:

    Certificates of Analysis (COA)

    Lot/Batch Number

    It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

    If you need assistance, please contact Customer Support.

    Already Own This Product?

    Find documentation for the products that you have recently purchased in the Document Library.

    Visit the Document Library

    Leticia M Ignacio-Souza et al.
    Endocrinology, 155(8), 2831-2844 (2014-06-04)
    In both human and experimental obesity, inflammatory damage to the hypothalamus plays an important role in the loss of the coordinated control of food intake and energy expenditure. Upon prolonged maintenance of increased body mass, the brain changes the defended
    Kaori Kojima et al.
    Neuroscience letters, 581, 37-41 (2014-08-26)
    p62, which is also called sequestosome 1 (SQSTM1), plays a critical role in neuronal cell death. However, the role of p62 in axonal degeneration remains unclear. We evaluated whether the modulation of p62 expression may affect axonal loss in tumor
    Young-Ok Son et al.
    The Journal of biological chemistry, 289(41), 28660-28675 (2014-08-27)
    The cadmium-transformed human lung bronchial epithelial BEAS-2B cells exhibit a property of apoptosis resistance as compared with normal non-transformed BEAS-2B cells. The level of basal reactive oxygen species (ROS) is extremely low in transformed cells in correlation with elevated expressions
    Young-Ok Son et al.
    The Journal of biological chemistry, 290(45), 27090-27100 (2015-09-20)
    Arsenic (As(3+)) is a carcinogen with considerable environmental and occupational relevancy. The present study shows that As(3+)-transformed human lung bronchial epithelial BEAS-2B cells (AsT cells) exhibit the property of apoptosis resistance. The level of basal reactive oxygen species (ROS) is
    Ashwani Khurana et al.
    Oncotarget, 6(34), 36354-36369 (2015-10-27)
    A promising new strategy for cancer therapy is to target the autophagic pathway. In the current study, we demonstrate that the antimalarial drug Quinacrine (QC) reduces cell viability and promotes chemotherapy-induced cell death in an autophagy-dependent manner more extensively in

    Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

    Contact Technical Service