Skip to Content
Merck
CN

EHU031921

MISSION® esiRNA

targeting human BST2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCGTAGAAGATTCCAGCACCCTCCCCTAACTCCAGGCCAGACTCTAAAGGGGAGATCTGGATGGCATCTACTTCGTATGACTATTGCAGAGTGCCCATGGAAGACGGGGATAAGCGCTGTAAGCTTCTGCTGGGGATAGGAATTCTGGTGCTCCTGATCATCGTGATTCTGGGGGTGCCCTTGATTATCTTCACCATCAAGGCCAACAGCGAGGCCTGCCGGGACGGCCTTCGGGCAGTGATGGAGTGTCGCAATGTCACCCATCTCCTGCAACAAGAGCTGACCGAGGCCCAGAAGGGCTTTCAGGATGTGGAGGCCCAGGCCGCCACCTGCAACCACACTGTGATGGCCCTAATGGCTTCCCTGGATGCAGAGAAGGCCCAAGGACAAAAGAAAGTGGAGGAGCTTGAGGGAGAGATCACTACATTAAACCATAAGCTTCAGGACGCGTCTGCAGAGGTGGAGCGACTGAGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... BST2(684)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weiyu Liu et al.
Biotechnology letters, 40(7), 1015-1027 (2018-05-19)
To investigate the functional roles of bone marrow stromal cell antigen 2 (BST2) in gastric cancer (GC) cells and its implications in the development of GC patients. BST2 was frequently overexpressed in GC tissues compared with the adjacent non-tumorous tissues
Eunbi Yi et al.
Biotechnology and bioengineering, 114(10), 2289-2297 (2017-05-13)
Despite all the advantages that cell-cultured influenza vaccines have over egg-based influenza vaccines, the inferior productivity of cell-culture systems is a major drawback that must be addressed. BST-2 (tetherin) is a host restriction factor which inhibits budding-out of various enveloped
Jérémie Prévost et al.
mBio, 10(3) (2019-06-20)
The HIV-1 accessory protein Vpu enhances viral release by counteracting the restriction factor BST-2. Furthermore, Vpu promotes NK cell evasion by downmodulating cell surface NTB-A and PVR, known ligands of the NK cell receptors NTB-A and DNAM-1, respectively. While it
Kerstin Gnirß et al.
Journal of virology, 89(18), 9178-9188 (2015-06-26)
The expression of the antiviral host cell factor tetherin is induced by interferon and can inhibit the release of enveloped viruses from infected cells. The Vpu protein of HIV-1 antagonizes the antiviral activity of tetherin, and tetherin antagonists with Vpu-like
Sonam Verma et al.
Cell adhesion & migration, 14(1), 24-41 (2020-01-21)
The mechanism by which interferon-gamma (IFN-γ) downregulates trophoblast invasion needs further investigation. Treatment of HTR-8/SVneo cells with IFN-γ led to a decrease in their invasion concomitant with an increased expression of BST2. Silencing of BST2 by siRNA showed a significant

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service