Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EHU031451

Sigma-Aldrich

MISSION® esiRNA

targeting human BRCA2

Sign Into View Organizational & Contract Pricing
All Photos(1)
UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGGCTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAATGTTCCCAATAGTAGACATAAAAGTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGTATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGGTCGTCAGACA

Ensembl | human accession no.

ENSG00000139618

NCBI accession no.

NM_000059

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BRCA2(675) , BRCA2(675)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

常规特殊物品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sukrit Mahajan et al.
The international journal of biochemistry & cell biology, 107, 128-139 (2018-12-28)
Cancer cells exhibit HR defects, increased proliferation and checkpoint aberrations. Tumour suppressor proteins, BRCA2 and p53 counteract such aberrant proliferation by checkpoint regulation. Intriguingly, chemo-resistant cancer cells, exhibiting mutated BRCA2 and p53 protein survive even with increased DNA damage accumulation.
Joshua R Heyza et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(8), 2523-2536 (2018-12-13)
ERCC1/XPF is a DNA endonuclease with variable expression in primary tumor specimens, and has been investigated as a predictive biomarker for efficacy of platinum-based chemotherapy. The failure of clinical trials utilizing ERCC1 expression to predict response to platinum-based chemotherapy suggests
Zdenek Skrott et al.
Oncogene, 38(40), 6711-6722 (2019-08-09)
Aldehyde dehydrogenase (ALDH) is a proposed biomarker and possible target to eradicate cancer stem cells. ALDH inhibition as a treatment approach is supported by anti-cancer effects of the alcohol-abuse drug disulfiram (DSF, Antabuse). Given that metabolic products of DSF, rather
Dusana Majera et al.
Cells, 9(2) (2020-02-23)
Research on repurposing the old alcohol-aversion drug disulfiram (DSF) for cancer treatment has identified inhibition of NPL4, an adaptor of the p97/VCP segregase essential for turnover of proteins involved in multiple pathways, as an unsuspected cancer cell vulnerability. While we
Weixing Zhao et al.
Nature, 550(7676), 360-365 (2017-10-05)
The tumour suppressor complex BRCA1-BARD1 functions in the repair of DNA double-stranded breaks by homologous recombination. During this process, BRCA1-BARD1 facilitates the nucleolytic resection of DNA ends to generate a single-stranded template for the recruitment of another tumour suppressor complex
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service