Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EHU026401

Sigma-Aldrich

MISSION® esiRNA

targeting human STIM1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCAGTCCGTAACATCCACAAACTGATGGACGATGATGCCAATGGTGATGTGGATGTGGAAGAAAGTGATGAGTTCCTGAGGGAAGACCTCAATTACCATGACCCAACAGTGAAACACAGCACCTTCCATGGTGAGGATAAGCTCATCAGCGTGGAGGACCTGTGGAAGGCATGGAAGTCATCAGAAGTATACAATTGGACCGTGGATGAGGTGGTACAGTGGCTGATCACATATGTGGAGCTGCCTCAGTATGAGGAGACCTTCCGGAAGCTGCAGCTCAGTGGCCATGCCATGCCAAGGCTGGCTGTCACCAACACCACCATGACAGGGACTGTGCTGAAGATGACAGACCGGAGTCATCGGCAGAAGCTGCAGCTGAAGGCTCTGGATACAGTGCTCTTTGGGCCTCCTCTCTT

Ensembl | human accession no.

ENSG00000167323

NCBI accession no.

NM_003156

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... STIM1(6786) , STIM1(6786)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

常规特殊物品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dongyu Wei et al.
Frontiers in cellular neuroscience, 11, 400-400 (2018-01-10)
Store-operated calcium channels (SOCs) are highly calcium-selective channels that mediate calcium entry in various cell types. We have previously reported that intraplantar injection of YM-58483 (a SOC inhibitor) attenuates chronic pain. A previous study has reported that the function of
Yadong Wang et al.
Oncotarget, 7(52), 86584-86593 (2016-11-20)
This study aimed to address the potential role of STIM1 (stromal interaction molecule 1) in lung tumorigenesis. Colony formation in soft agar assay and tumorigenicity in nude mice assay were conducted. Western blot, immunohistochemistry and quantitative real-time polymerase chain reaction
Yan-Yang Mao et al.
Biochemical and biophysical research communications, 505(1), 119-125 (2018-09-23)
The prevention and treatment of coronary heart disease (CHD) is a difficult problem to be solved. More and more studies have found that circular RNAs (circRNAs) may play important roles in the development of CHD. Here detection of vascular smooth
Ping Li et al.
PloS one, 12(5), e0177484-e0177484 (2017-05-12)
Calcium signal plays an important role in a variety of cancer cell metabolism, but knowledge on its role in head and neck squamous cell carcinoma (HNSCC) is limited. Store-operated calcium entry (SOCE) is the principal Ca2+ entry mechanism that maintains
Francesco Lodola et al.
PloS one, 7(9), e42541-e42541 (2012-10-11)
Endothelial progenitor cells (EPCs) may be recruited from bone marrow to sustain tumor vascularisation and promote the metastatic switch. Understanding the molecular mechanisms driving EPC proliferation and tubulogenesis could outline novel targets for alternative anti-angiogenic treatments. Store-operated Ca(2+) entry (SOCE)
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service