Skip to Content
Merck
CN

EHU020301

MISSION® esiRNA

targeting human HDAC11

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCTCAAGTGGTCCTTTGCTGTTGCTACCATCACAGAAATCCCCCCCGTTATCTTCCTCCCCAACTTCCTTGTGCAGAGGAAGGTGCTGAGGCCCCTTCGGACCCAGACAGGAGGAACCATAATGGCGGGGAAGCTGGCTGTGGAGCGAGGCTGGGCCATCAACGTGGGGGGTGGCTTCCACCACTGCTCCAGCGACCGTGGCGGGGGCTTCTGTGCCTATGCGGACATCACGCTCGCCATCAAGTTTCTGTTTGAGCGTGTGGAGGGCATCTCCAGGGCTACCATCATTGATCTTGATGCCCATCAGGGCAATGGGCATGAGCGAGACTTCATGGACGACAAGCGTGTGTACATCATGGATGTCTACAACCGCCACATCTACCCAGGGGACCGCTTTGCCAAGCAGGCCATCAGGCGGAAGGTGGAGCTGGAGTGGGGCACAGAGGATGATGAGTACCTGGATAAGGTGGAGAGGAACATCAAGAAATCCCTCCAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Li Yuan et al.
Journal of molecular and cellular cardiology, 122, 1-10 (2018-08-01)
Immune deregulation is a causative factor in pathogenesis of myocarditis. Histone deacetylases (HDAC) involve multiple biochemical activities in the cell. This study aims to elucidate the role of HDAC11 in the regulation of interleukin (IL)-13-expression in CD4+ T cells of
Shashi Bala et al.
Journal of leukocyte biology, 102(2), 487-498 (2017-06-07)
Inflammation promotes the progression of alcoholic liver disease. Alcohol sensitizes KCs to gut-derived endotoxin (LPS); however, signaling pathways that perpetuate inflammation in alcoholic liver disease are only partially understood. We found that chronic alcohol feeding in mice induced miR-155, an
Ming-Yang Li et al.
Oncotarget, 7(48), 79914-79924 (2016-11-09)
The regulatory B cells (Breg) are important in the body immunity. The differentiation process of Breg is not fully understood yet. Ubiquitin A20 has immune regulatory functions. This study aims to investigate the role of A20 in the regulation of

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service