Skip to Content
Merck
CN

EHU017331

MISSION® esiRNA

targeting human TIMP2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCCAAGCAGGAGTTTCTCGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shanlan Yin et al.
Experimental and therapeutic medicine, 17(4), 2837-2846 (2019-03-25)
Human papillomaviruses (HPVs) have important roles in the development and progression of cervical cancer, but the underlying mechanisms are yet to be fully elucidated. MicroRNA-130a (miR-130a) has previously been reported to promote cervical cancer growth. However, the underlying molecular mechanisms
Guijun Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 118, 109309-109309 (2019-09-24)
To explore the roles of long noncoding RNA (lncRNA) FOXF1 Adjacent Non-Coding Developmental Regulatory RNA (FENDRR) in human non-small cell lung cancer (NSCLC). The levels of FENDRR in NSCLC cells and tissues were analyzed using qRT-PCR assay. The growth and
Ji-Xiang Cao
Oncology reports, 41(6), 3367-3376 (2019-04-20)
Aberrantly expressed miRNAs play a crucial role in the progression of lung adenocarcinoma. However, to date, the role of miR‑888 in lung adenocarcinoma progression is unclear. In the present study, the biological function of miR‑888 and its underlying mechanism in
Yinghua Guo et al.
The international journal of biochemistry & cell biology, 99, 203-210 (2018-04-21)
Radiotherapy is a widely used effective treatment for lung cancer in clinic. MicroRNAs (miRNAs) have been proved to play an important role in radiation response. This study aimed to explore the regulatory role and mechanism of miR-373 in lung cancer
Yuan Cheng et al.
Molecular medicine reports, 16(4), 5464-5470 (2017-08-30)
Human papillomavirus (HPV) infection alone is not sufficient for development of cervical cancer and further risk factors are involved, however, the underlying mechanism remains to be elucidated. The authors previously used a microarray assay to reveal microR‑20b (miR‑20b) as a key

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service