Skip to Content
Merck
CN
All Photos(1)

Key Documents

Safety Information

EHU012751

Sigma-Aldrich

MISSION® esiRNA

targeting human LEP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGAAAGTCACCGGTTTGGACTTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTCTACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTGGAGAACCTCCGGGATCTTCTTCACGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGGGGTGTCCTGGAAGCTTCAGGCTACTCCACAGAGGTGGTGGCCCTGAGCAGGCTGCAGGGGTCTCTGCAGGACATGCTGTGGCAGCTGGACCTCAGCCCTGGGTGCTGAGGCCTTGAAGGTCACTCTTCCTGCAAGGACTACGTTAAGGGAAGGAACTCTGGCTTCCAGGTATCTCCAGGATTGAAGAGCATTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Beniamin Oskar Grabarek et al.
International journal of molecular sciences, 22(4) (2021-02-11)
Psoriasis is a disease with a proinflammatory base, in which an increased expression of leptin, tumor necrosis factor alpha (TNF-α), interleukin (IL) IL-12/23, IL-6, is observed. A drug used in the treatment of psoriasis of moderate and acute strength is
Dariusz Dąbruś et al.
International journal of molecular sciences, 21(11) (2020-06-14)
This research aimed to assess the impact of cisplatin, depending on the concentration and exposure time, on the expression pattern of leptin in an endometrial cancer cell line. Ishikawa endometrial cancer cell cultures were incubated with cisplatin, at concentrations of
Amy L Strong et al.
Breast cancer research : BCR, 17, 112-112 (2015-08-20)
The steady increase in the incidence of obesity among adults has been paralleled with higher levels of obesity-associated breast cancer. While recent studies have suggested that adipose stromal/stem cells (ASCs) isolated from obese women enhance tumorigenicity, the mechanism(s) by which

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service