Skip to Content
Merck
CN
All Photos(1)

Key Documents

Safety Information

EHU010511

Sigma-Aldrich

MISSION® esiRNA

targeting human VANGL2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGAAGAGGAGCAGAAAAACCCCAGGGAGGTGATGGACCCCCGGGAGGCAGCCCAAGCCATCTTTGCATCCATGGCCCGTGCCATGCAGAAGTACCTTCGGACCACCAAGCAGCAGCCCTACCACACCATGGAGAGCATCCTGCAGCACCTTGAATTCTGCATCACGCATGACATGACGCCCAAGGCCTTCTTGGAGCGATACTTGGCGGCTGGACCTACCATCCAGTACCACAAGGAACGCTGGCTGGCCAAACAGTGGACATTGGTGAGCGAGGAGCCGGTGACCAACGGCCTCAAGGATGGCATCGTTTTCCTCTTAAAACGCCAGGACTTCAGCCTGGTGGTCAGCACCAAGAAGGTCCCATTCTTCAAACTCTCCGAGGAATTTGTGGATCCCAAGTCACACAAGTTTGTCATGAGGCTGCAGTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhaoming Wu et al.
Cell and tissue research, 366(3), 617-621 (2016-09-04)
Vangl2, one of the core components of the planar cell polarity (PCP) pathway, has an important role in the regulation of morphogenesis in several tissues. Although the expression of Vangl2 has been detected in the developing tooth, its role in
Tania M Puvirajesinghe et al.
Nature communications, 7, 10318-10318 (2016-01-13)
The non-canonical Wnt/planar cell polarity (Wnt/PCP) pathway plays a crucial role in embryonic development. Recent work has linked defects of this pathway to breast cancer aggressiveness and proposed Wnt/PCP signalling as a therapeutic target. Here we show that the archetypal
Sek-Shir Cheong et al.
Frontiers in cell and developmental biology, 8, 577201-577201 (2020-11-17)
VANGL2 is a component of the planar cell polarity (PCP) pathway, which regulates tissue polarity and patterning. The Vangl2 Lp mutation causes lung branching defects due to dysfunctional actomyosin-driven morphogenesis. Since the actomyosin network regulates cell mechanics, we speculated that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service