Skip to Content
Merck
CN

EHU009691

MISSION® esiRNA

targeting human RND3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCGGCTGCAAGTCTGATCTGCGGACAGATGTTAGTACATTAGTAGAGCTCTCCAATCACAGGCAGACGCCAGTGTCCTATGACCAGGGGGCAAATATGGCCAAACAGATTGGAGCAGCTACTTATATCGAATGCTCAGCTTTACAGTCGGAAAATAGCGTCAGAGACATTTTTCACGTTGCCACCTTGGCATGTGTAAATAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGAGCCACAAAGCGGATTTCACACATGCCTAGCAGACCAGAACTCTCGGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGCTGCACTGTGATGTGAATCTTTCATTATCTTTAATGAAGACAAAGGAATCTAGTGTAAAAAACAACAGCAAACAAAAAGGTGAAGTCTAAATGAAGTGCACAGCCAAAGTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chen Jiang et al.
Cancer research, 80(10), 1957-1969 (2020-02-16)
Nasopharyngeal carcinoma is an Epstein-Barr virus (EBV)-related malignancy. Recently, we found that the EBV-encoded miRNA BART2-5p was increased in the serum of patients with preclinical nasopharyngeal carcinoma and that the copy number positively correlated with disease progression. In this study
Marta Hernández-Sánchez et al.
Oncotarget, 6(19), 17479-17490 (2015-06-04)
RhoE is a small GTPase involved in the regulation of actin cytoskeleton dynamics, cell cycle and apoptosis. The role of RhoE in cancer is currently controversial, with reports of both oncogenic and tumor-suppressive functions for RhoE. Using RhoE-deficient mice, we
Kim Clarke et al.
PLoS genetics, 11(7), e1005325-e1005325 (2015-07-02)
Gliomas are a highly heterogeneous group of brain tumours that are refractory to treatment, highly invasive and pro-angiogenic. Glioblastoma patients have an average survival time of less than 15 months. Understanding the molecular basis of different grades of glioma, from
Yuan Dai et al.
Communications biology, 3(1), 572-572 (2020-10-17)
The Rho family of GTPases consists of 20 members including RhoE. Here, we discover the existence of a short isoform of RhoE designated as RhoEα, the first Rho GTPase isoform generated from alternative translation. Translation of this new isoform is

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service