Skip to Content
Merck
CN

EHU007531

MISSION® esiRNA

targeting human CDCA5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTTGAAAACGGAGCTGGATGAGTGGGCTGCGGCCATGAATGCCGAGTTTGAAGCTGCTGAGCAGTTTGATCTCCTGGTTGAATGAGATGCAGTGGGGGGTGCACCTGGCCAGACTCTCCCTCCTGTCCTGTACATAGCCACCTCCCTGTGGAGAGGACACTTAGGGTCCCCTCCCCTGGTCTTGTTACCTGTGTGTGTGCTGGTGCTGCGCATGAGGACTGTCTGCCTTTGAGGGCTTGGGCAGCAGCGGCAGCCATCTTGGTTTTAGGAAATGGGGCCGCCTGGCCCAGCCACTCACTGGTGTCCTGTCTCTTGTCGTCCTGTCCTTCCTATCTCCCCAAAGTACCATAGCCAGTTTCCAGATGGGCCACAGACTGGGGAGGAGAATCAGTGGCCCAGCCAGAAGTTAAAGGGCTGAGGGTTGAGGTGAGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jianlin Wang et al.
Oncology reports, 40(4), 1875-1884 (2018-07-18)
Cell division cycle associated 5 (CDCA5) has been associated with the progression of several types of cancers. However, its possible role and mechanism in hepatocellular carcinoma (HCC) remain unknown. In the present study, immunohistochemical staining and real‑time PCR were used to
Chun-Jie Huang et al.
In vitro cellular & developmental biology. Animal, 53(3), 258-264 (2016-11-09)
Maintenance and timely termination of cohesion on chromosomes ensures accurate chromosome segregation to guard against aneuploidy in mammalian oocytes and subsequent chromosomally abnormal pregnancies. Sororin, a cohesion stabilizer whose relevance in antagonizing the anti-cohesive property of Wings-apart like protein (Wapl)
Tatsuya Kato et al.
International journal of oncology, 49(6), 2411-2420 (2016-11-15)
Malignant pleural mesothelioma (MPM) is an aggressive type of cancer of the thoracic cavity commonly associated with asbestos exposure and a high mortality rate. There is a need for new molecular targets for the development of more effective therapies for

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service