Skip to Content
Merck
CN

EHU004421

MISSION® esiRNA

targeting human BMI1, COMMD3-BMI1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Gene Information

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCATCCTTCTGCTGATGCTGCCAATGGCTCTAATGAAGATAGAGGAGAGGTTGCAGATGAAGATAAGAGAATTATAACTGATGATGAGATAATAAGCTTATCCATTGAATTCTTTGACCAGAACAGATTGGATCGGAAAGTAAACAAAGACAAAGAGAAATCTAAGGAGGAGGTGAATGATAAAAGATACTTACGATGCCCAGCAGCAATGACTGTGATGCACTTAAGAAAGTTTCTCAGAAGTAAAATGGACATACCTAATACTTTCCAGATTGATGTCATGTATGAGGAGGAACCTTTAAAGGATTATTATACACTAATGGATATTGCCTACATTTATACCTGGAGAAGGAATGGTCCACTTCCATTGAAATACAGAGTTCGACCTACTTGTAAAAGAATGAAGATCAGTCACCAGAGAGATGGACTGACAAATGCTGGAGAACTGGAAAGTGACTCTGGGAGTGACAAGGCCAACAGCCCAGCAGGAGGTATTCCCTCCACCTCTTCTTGTTTGCCTAGCCCCAGTACTCCAGTGCAGTCTCCTCATCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fan Xu et al.
Experimental and therapeutic medicine, 14(3), 2216-2220 (2017-10-01)
The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin
M H Shahi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(11), 15107-15114 (2016-09-25)
Chemoresistance is a common hurdle for the proper treatment of gliomas. The role of Shh-Gli1 signaling in glioma progression has been reported. However, its role in glioma chemoresistance has not been well studied yet. In this work, we found that
M Hiraki et al.
Oncogene, 36(20), 2791-2801 (2016-11-29)
B-cell-specific Moloney murine leukemia virus integration site 1 (BMI1) is a component of the polycomb repressive complex 1 (PRC1) complex that is overexpressed in breast and other cancers, and promotes self-renewal of cancer stem-like cells. The oncogenic mucin 1 (MUC1)
Hexiang Wang et al.
Biochemical and biophysical research communications, 537, 22-28 (2021-01-01)
Triple-negative breast cancer (TNBC) is a major challenge in clinical practice due to its aggressiveness and lack of targeted treatment. Cancer stem-like traits contribute to tumorigenesis and immune privilege of TNBC. However, the relationship of stemness and immunosurveillance remains unclear.
Reigetsu Yoshikawa et al.
BMC cancer, 12, 461-461 (2012-10-11)
The polycomb group (PcG) family BMI1, acting downstream of the hedgehog (Hh) pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service