Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EHU001001

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF1A

Sign Into View Organizational & Contract Pricing

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCAAGTGCCACAAAGGAACCTACTTGTACAATGACTGTCCAGGCCCGGGGCAGGATACGGACTGCAGGGAGTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAACCACCTCAGACACTGCCTCAGCTGCTCCAAATGCCGAAAGGAAATGGGTCAGGTGGAGATCTCTTCTTGCACAGTGGACCGGGACACCGTGTGTGGCTGCAGGAAGAACCAGTACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAATTGCAGCCTCTGCCTCAATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACACCGTGTGCACCTGCCATGCAGGTTTCTTTCTAAGAGAAAACGAGTGTGTCTCCTGTAGTAACTGTAAGAAAAGCCTGGAGTGCACGAAGTTGTGCCTACCCCAGATTGAGAATGTTAAGGGCACTGAGGACTCAGGCACCACAGTGCTGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCCTCCTCTTCATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCCATTGTTTGTGGGAAATCGACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yang Yu et al.
American journal of physiology. Heart and circulatory physiology, 313(4), H744-H756 (2017-07-16)
In systolic heart failure (HF), circulating proinflammatory cytokines upregulate inflammation and renin-angiotensin system (RAS) activity in cardiovascular regions of the brain, contributing to sympathetic excitation and cardiac dysfunction. Important among these is the subfornical organ (SFO), a forebrain circumventricular organ
Susana P Egusquiaguirre et al.
Neoplasia (New York, N.Y.), 20(5), 489-498 (2018-04-06)
The transcription factor STAT3 is activated inappropriately in 70% of breast cancers, most commonly in triple negative breast cancer (TNBC). Although the transcriptional function of STAT3 is essential for tumorigenesis, the key target genes regulated by STAT3 in driving tumor
Hui Xu et al.
Toxicology letters, 280, 171-180 (2017-09-03)
Dysregulation of microRNAs (miRNAs) has been implicated in the pathogenesis of chronic obstructive pulmonary disease (COPD), which is largely attributable to cigarette smoke (CS). However, little is known about the effect of miRNAs on CS-induced mucus hypersecretion and the inflammatory
Xusheng Wang et al.
Nature communications, 8, 14091-14091 (2017-03-28)
Skin stem cells can regenerate epidermal appendages; however, hair follicles (HF) lost as a result of injury are barely regenerated. Here we show that macrophages in wounds activate HF stem cells, leading to telogen-anagen transition (TAT) around the wound and
Ruizhe Zhao et al.
Cell proliferation, 51(3), e12415-e12415 (2017-12-02)
Urinary tract infection, urinary frequency, urgency, urodynia and haemorrhage are common post-operative complications of thulium laser resection of the prostate (TmLRP). Our study mainly focuses on the role of finasteride in prostate wound healing through AR signalling. TmLRP beagles were

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service