Skip to Content
Merck
CN

EHU000841

MISSION® esiRNA

targeting human KIT

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTACAACGATGTGGGCAAGACTTCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCACACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATTGTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATCACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCTTTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACTGTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCTGAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... KIT(3815)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sook-Kyoung Heo et al.
Scientific reports, 7(1), 15278-15278 (2017-11-12)
Dasatinib and radotinib are oral BCR-ABL tyrosine kinase inhibitors that were developed as drugs for the treatment of chronic myeloid leukemia. We report here that the c-KIT (CD117) targeting with dasatinib and radotinib promotes acute myeloid leukemia (AML) cell death
Kyung-Hwa Lee et al.
Oncotarget, 6(5), 3240-3253 (2015-01-22)
KITENIN (KAI1 COOH-terminal interacting tetraspanin) promotes tumor invasion and metastasis in various cancers. This study assessed the association between KITENIN expression and advanced glioma grade in patients. In vitro assays revealed that KITENIN knockdown inhibited the invasion and migration of
Erola Ainsua-Enrich et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4309-4318 (2015-03-27)
SH3-binding protein 2 (3BP2) is a cytoplasmic adaptor protein that acts as a positive regulator in mast cell FcεRI-dependent signaling. The KIT receptor whose ligand is the stem cell factor is necessary for mast cell development, proliferation, and survival as
Gaurang Trivedi et al.
Science translational medicine, 11(511) (2019-09-27)
Adult stem and progenitor cells are uniquely capable of self-renewal, and targeting this process represents a potential therapeutic opportunity. The early erythroid progenitor, burst-forming unit erythroid (BFU-E), has substantial self-renewal potential and serves as a key cell type for the
Yanli Jin et al.
Cancer letters, 353(1), 115-123 (2014-08-05)
Gain-of-function mutations of receptor tyrosine kinase KIT play a critical role in the pathogenesis of systemic mastocytosis (SM) and gastrointestinal stromal tumors. D816V KIT mutation, found in ∼80% of SM, is resistant to the currently available tyrosine kinase inhibitors (TKIs)

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service